Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 4030478..4030623 | Replicon | chromosome |
| Accession | NZ_CP091566 | ||
| Organism | Salmonella enterica strain 137 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 4030480..4030583 (-) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 4030478..4030623 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| INN76_RS19630 | 4025606..4025806 | + | 201 | WP_010989029.1 | PagK family vesicle-borne virulence factor | - |
| INN76_RS19635 | 4025903..4026373 | - | 471 | Protein_3831 | tail fiber assembly protein | - |
| INN76_RS19640 | 4026383..4026727 | - | 345 | Protein_3832 | macro domain-containing protein | - |
| INN76_RS19645 | 4026942..4027202 | - | 261 | Protein_3833 | DUF1441 family protein | - |
| INN76_RS19650 | 4027257..4027445 | + | 189 | WP_001521334.1 | hypothetical protein | - |
| INN76_RS19655 | 4027510..4027677 | + | 168 | WP_000789530.1 | lytic enzyme | - |
| INN76_RS19660 | 4027934..4028467 | - | 534 | WP_001050882.1 | DUF2514 domain-containing protein | - |
| INN76_RS19665 | 4028521..4028712 | - | 192 | Protein_3837 | glycoside hydrolase family 19 protein | - |
| INN76_RS19670 | 4028701..4029162 | + | 462 | Protein_3838 | DNA breaking-rejoining protein | - |
| INN76_RS19675 | 4029426..4030349 | + | 924 | Protein_3839 | tyrosine-type recombinase/integrase | - |
| - | 4030478..4030623 | + | 146 | - | - | Antitoxin |
| - | 4030480..4030583 | - | 104 | - | - | Toxin |
| INN76_RS19680 | 4030723..4031076 | - | 354 | WP_000722368.1 | YebY family protein | - |
| INN76_RS19685 | 4031093..4031968 | - | 876 | WP_000979702.1 | copper homeostasis membrane protein CopD | - |
| INN76_RS19690 | 4031969..4032343 | - | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| INN76_RS19695 | 4032481..4032711 | + | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| INN76_RS19700 | 4032819..4033475 | + | 657 | WP_000100258.1 | carbon-nitrogen hydrolase family protein | - |
| INN76_RS19705 | 4033499..4034197 | + | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| inside | Prophage | - | sopE2 | 3997966..4052491 | 54525 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T233820 NZ_CP091566:c4030583-4030480 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT233820 NZ_CP091566:4030478-4030623 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG