Detailed information of TA system    

insolicoBioinformatically predicted

Overview

TA module


Type VIII Classification (family/domain) SdsR-RyeA/-
Location 4030478..4030623 Replicon chromosome
Accession NZ_CP091566
Organism Salmonella enterica strain 137

Toxin (RNA)


Gene name SdsR
Locus tag -
Coordinates 4030480..4030583 (-)

Antitoxin (RNA)


Gene name RyeA
Locus tag -
Coordinates 4030478..4030623 (+)

Genomic Context

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
INN76_RS19630 4025606..4025806 + 201 WP_010989029.1 PagK family vesicle-borne virulence factor -
INN76_RS19635 4025903..4026373 - 471 Protein_3831 tail fiber assembly protein -
INN76_RS19640 4026383..4026727 - 345 Protein_3832 macro domain-containing protein -
INN76_RS19645 4026942..4027202 - 261 Protein_3833 DUF1441 family protein -
INN76_RS19650 4027257..4027445 + 189 WP_001521334.1 hypothetical protein -
INN76_RS19655 4027510..4027677 + 168 WP_000789530.1 lytic enzyme -
INN76_RS19660 4027934..4028467 - 534 WP_001050882.1 DUF2514 domain-containing protein -
INN76_RS19665 4028521..4028712 - 192 Protein_3837 glycoside hydrolase family 19 protein -
INN76_RS19670 4028701..4029162 + 462 Protein_3838 DNA breaking-rejoining protein -
INN76_RS19675 4029426..4030349 + 924 Protein_3839 tyrosine-type recombinase/integrase -
- 4030478..4030623 + 146 - - Antitoxin
- 4030480..4030583 - 104 - - Toxin
INN76_RS19680 4030723..4031076 - 354 WP_000722368.1 YebY family protein -
INN76_RS19685 4031093..4031968 - 876 WP_000979702.1 copper homeostasis membrane protein CopD -
INN76_RS19690 4031969..4032343 - 375 WP_000168393.1 CopC domain-containing protein YobA -
INN76_RS19695 4032481..4032711 + 231 WP_000856224.1 DNA polymerase III subunit theta -
INN76_RS19700 4032819..4033475 + 657 WP_000100258.1 carbon-nitrogen hydrolase family protein -
INN76_RS19705 4033499..4034197 + 699 WP_000944282.1 exodeoxyribonuclease X -

Associated MGEs

MGE
detail		 Similar
MGEs		 Relative
position		 MGE Type Cargo ARG Virulence gene Coordinates Length (bp)
inside Prophage - sopE2 3997966..4052491 54525


Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.


Sequences

Toxin        


Download         Length: 104 bp

>T233820 NZ_CP091566:c4030583-4030480 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT

Antitoxin


Download         Length: 146 bp

>AT233820 NZ_CP091566:4030478-4030623 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG

Structures

Antitoxin

Download structure file

Antitoxin

Download structure file

References