Detailed information of TA system    

insolicoBioinformatically predicted

Overview

TA module


Type VIII Classification (family/domain) SdsR-RyeA/-
Location 2144617..2144762 Replicon chromosome
Accession NZ_CP090529
Organism Salmonella enterica strain 2008079-SE

Toxin (RNA)


Gene name SdsR
Locus tag -
Coordinates 2144657..2144760 (+)

Antitoxin (RNA)


Gene name RyeA
Locus tag -
Coordinates 2144617..2144762 (-)

Genomic Context

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
L0F60_RS10485 2141043..2141741 - 699 WP_000944282.1 exodeoxyribonuclease X -
L0F60_RS10490 2141765..2142421 - 657 WP_000100258.1 carbon-nitrogen hydrolase family protein -
L0F60_RS10495 2142529..2142759 - 231 WP_000856224.1 DNA polymerase III subunit theta -
L0F60_RS10500 2142897..2143271 + 375 WP_000168393.1 CopC domain-containing protein YobA -
L0F60_RS10505 2143272..2144147 + 876 WP_000979702.1 copper homeostasis membrane protein CopD -
L0F60_RS10510 2144164..2144517 + 354 WP_000722368.1 YebY family protein -
- 2144617..2144762 - 146 - - Antitoxin
- 2144657..2144760 + 104 - - Toxin
L0F60_RS10515 2144891..2145814 - 924 Protein_2063 tyrosine-type recombinase/integrase -
L0F60_RS10520 2146078..2146539 - 462 Protein_2064 DNA breaking-rejoining protein -
L0F60_RS10525 2146528..2146719 + 192 Protein_2065 glycoside hydrolase family 19 protein -
L0F60_RS10530 2146773..2147306 + 534 WP_001050882.1 DUF2514 domain-containing protein -
L0F60_RS10535 2147563..2147730 - 168 WP_000789530.1 lytic enzyme -
L0F60_RS10540 2147795..2147983 - 189 WP_001521334.1 hypothetical protein -
L0F60_RS10545 2148038..2148298 + 261 Protein_2069 DUF1441 family protein -
L0F60_RS10550 2148513..2148857 + 345 Protein_2070 macro domain-containing protein -
L0F60_RS10555 2148867..2149337 + 471 Protein_2071 tail fiber assembly protein -
L0F60_RS10560 2149434..2149634 - 201 WP_010989029.1 PagK family vesicle-borne virulence factor -

Associated MGEs

MGE
detail		 Similar
MGEs		 Relative
position		 MGE Type Cargo ARG Virulence gene Coordinates Length (bp)
inside Prophage - sopE2 2122749..2177274 54525


Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.


Sequences

Toxin        


Download         Length: 104 bp

>T231019 NZ_CP090529:2144657-2144760 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT

Antitoxin


Download         Length: 146 bp

>AT231019 NZ_CP090529:c2144762-2144617 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG

Structures

Antitoxin

Download structure file

Antitoxin

Download structure file

References