Detailed information of TA system    

insolicoBioinformatically predicted

Overview

TA module


Type VIII Classification (family/domain) SdsR-RyeA/-
Location 2256555..2256698 Replicon chromosome
Accession NZ_CP085983
Organism Salmonella enterica strain SZL 31

Toxin (RNA)


Gene name SdsR
Locus tag -
Coordinates 2256593..2256696 (+)

Antitoxin (RNA)


Gene name RyeA
Locus tag -
Coordinates 2256555..2256698 (-)

Genomic Context

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
LJY15_RS10950 2252979..2253677 - 699 WP_000944278.1 exodeoxyribonuclease X -
LJY15_RS10955 2253701..2254357 - 657 WP_000100256.1 nitrilase-related carbon-nitrogen hydrolase -
LJY15_RS10960 2254465..2254695 - 231 WP_000856224.1 DNA polymerase III subunit theta -
LJY15_RS10965 2254833..2255207 + 375 WP_000168393.1 CopC domain-containing protein YobA -
LJY15_RS10970 2255208..2256083 + 876 WP_000979694.1 copper homeostasis membrane protein CopD -
LJY15_RS10975 2256100..2256453 + 354 WP_000722368.1 YebY family protein -
- 2256555..2256698 - 144 - - Antitoxin
- 2256593..2256696 + 104 - - Toxin
LJY15_RS10980 2256856..2257749 - 894 Protein_2132 tyrosine-type recombinase/integrase -
LJY15_RS10985 2258013..2258474 - 462 Protein_2133 DNA breaking-rejoining protein -
LJY15_RS10990 2258463..2258654 + 192 Protein_2134 glycoside hydrolase family 19 protein -
LJY15_RS10995 2258708..2259241 + 534 WP_001050883.1 DUF2514 domain-containing protein -
LJY15_RS11000 2259498..2259665 - 168 WP_000789529.1 lytic enzyme -
LJY15_RS11005 2259973..2260233 + 261 Protein_2137 DUF1441 family protein -
LJY15_RS24460 2260235..2260450 + 216 Protein_2138 shikimate transporter -
LJY15_RS24465 2260460..2260747 + 288 Protein_2139 macro domain-containing protein -
LJY15_RS11015 2260760..2261271 + 512 Protein_2140 tail fiber assembly protein -
LJY15_RS11020 2261368..2261568 - 201 WP_010989029.1 PagK family vesicle-borne virulence factor -

Associated MGEs

MGE
detail		 Similar
MGEs		 Relative
position		 MGE Type Cargo ARG Virulence gene Coordinates Length (bp)
inside Prophage - sopE2 2250893..2289204 38311


Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.


Sequences

Toxin        


Download         Length: 104 bp

>T222386 NZ_CP085983:2256593-2256696 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT

Antitoxin


Download         Length: 144 bp

>AT222386 NZ_CP085983:c2256698-2256555 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG

Structures

Antitoxin

Download structure file

Antitoxin

Download structure file

References