Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2009725..2009870 | Replicon | chromosome |
| Accession | NZ_CP085696 | ||
| Organism | Salmonella enterica subsp. enterica serovar Saintpaul strain S25 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2009765..2009868 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2009725..2009870 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| LJN58_RS09680 | 2006151..2006849 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
| LJN58_RS09685 | 2006873..2007529 | - | 657 | WP_000100258.1 | carbon-nitrogen hydrolase family protein | - |
| LJN58_RS09690 | 2007637..2007867 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| LJN58_RS09695 | 2008005..2008379 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| LJN58_RS09700 | 2008380..2009255 | + | 876 | WP_000979702.1 | copper homeostasis membrane protein CopD | - |
| LJN58_RS09705 | 2009272..2009625 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2009725..2009870 | - | 146 | - | - | Antitoxin |
| - | 2009765..2009868 | + | 104 | - | - | Toxin |
| LJN58_RS09710 | 2009999..2010922 | - | 924 | Protein_1897 | tyrosine-type recombinase/integrase | - |
| LJN58_RS09715 | 2011186..2011647 | - | 462 | Protein_1898 | DNA breaking-rejoining protein | - |
| LJN58_RS09720 | 2011636..2011827 | + | 192 | Protein_1899 | glycoside hydrolase family 19 protein | - |
| LJN58_RS09725 | 2011881..2012414 | + | 534 | WP_001050882.1 | DUF2514 domain-containing protein | - |
| LJN58_RS09730 | 2012671..2012838 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| LJN58_RS09735 | 2012903..2013091 | - | 189 | WP_001521334.1 | hypothetical protein | - |
| LJN58_RS09740 | 2013146..2013406 | + | 261 | Protein_1903 | DUF1441 family protein | - |
| LJN58_RS25185 | 2013408..2013623 | + | 216 | Protein_1904 | shikimate transporter | - |
| LJN58_RS25190 | 2013621..2013965 | + | 345 | Protein_1905 | macro domain-containing protein | - |
| LJN58_RS09750 | 2013975..2014445 | + | 471 | Protein_1906 | tail fiber assembly protein | - |
| LJN58_RS09755 | 2014542..2014742 | - | 201 | WP_010989029.1 | PagK family vesicle-borne virulence factor | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| inside | Prophage | - | sopE2 | 2002388..2042389 | 40001 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T221070 NZ_CP085696:2009765-2009868 [Salmonella enterica subsp. enterica serovar Saintpaul]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT221070 NZ_CP085696:c2009870-2009725 [Salmonella enterica subsp. enterica serovar Saintpaul]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
