Detailed information of TA system    

insolicoBioinformatically predicted

Overview

TA module


Type VIII Classification (family/domain) SdsR-RyeA/-
Location 2009725..2009870 Replicon chromosome
Accession NZ_CP085696
Organism Salmonella enterica subsp. enterica serovar Saintpaul strain S25

Toxin (RNA)


Gene name SdsR
Locus tag -
Coordinates 2009765..2009868 (+)

Antitoxin (RNA)


Gene name RyeA
Locus tag -
Coordinates 2009725..2009870 (-)

Genomic Context

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
LJN58_RS09680 2006151..2006849 - 699 WP_000944282.1 exodeoxyribonuclease X -
LJN58_RS09685 2006873..2007529 - 657 WP_000100258.1 carbon-nitrogen hydrolase family protein -
LJN58_RS09690 2007637..2007867 - 231 WP_000856224.1 DNA polymerase III subunit theta -
LJN58_RS09695 2008005..2008379 + 375 WP_000168393.1 CopC domain-containing protein YobA -
LJN58_RS09700 2008380..2009255 + 876 WP_000979702.1 copper homeostasis membrane protein CopD -
LJN58_RS09705 2009272..2009625 + 354 WP_000722368.1 YebY family protein -
- 2009725..2009870 - 146 - - Antitoxin
- 2009765..2009868 + 104 - - Toxin
LJN58_RS09710 2009999..2010922 - 924 Protein_1897 tyrosine-type recombinase/integrase -
LJN58_RS09715 2011186..2011647 - 462 Protein_1898 DNA breaking-rejoining protein -
LJN58_RS09720 2011636..2011827 + 192 Protein_1899 glycoside hydrolase family 19 protein -
LJN58_RS09725 2011881..2012414 + 534 WP_001050882.1 DUF2514 domain-containing protein -
LJN58_RS09730 2012671..2012838 - 168 WP_000789530.1 lytic enzyme -
LJN58_RS09735 2012903..2013091 - 189 WP_001521334.1 hypothetical protein -
LJN58_RS09740 2013146..2013406 + 261 Protein_1903 DUF1441 family protein -
LJN58_RS25185 2013408..2013623 + 216 Protein_1904 shikimate transporter -
LJN58_RS25190 2013621..2013965 + 345 Protein_1905 macro domain-containing protein -
LJN58_RS09750 2013975..2014445 + 471 Protein_1906 tail fiber assembly protein -
LJN58_RS09755 2014542..2014742 - 201 WP_010989029.1 PagK family vesicle-borne virulence factor -

Associated MGEs

MGE
detail		 Similar
MGEs		 Relative
position		 MGE Type Cargo ARG Virulence gene Coordinates Length (bp)
inside Prophage - sopE2 2002388..2042389 40001


Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.


Sequences

Toxin        


Download         Length: 104 bp

>T221070 NZ_CP085696:2009765-2009868 [Salmonella enterica subsp. enterica serovar Saintpaul]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT

Antitoxin


Download         Length: 146 bp

>AT221070 NZ_CP085696:c2009870-2009725 [Salmonella enterica subsp. enterica serovar Saintpaul]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG

Structures

Antitoxin

Download structure file

Antitoxin

Download structure file

References