Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2101731..2101876 | Replicon | chromosome |
| Accession | NZ_CP081187 | ||
| Organism | Salmonella enterica strain sg1722-1 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2101771..2101874 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2101731..2101876 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| K4F82_RS10145 | 2098157..2098855 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
| K4F82_RS10150 | 2098879..2099535 | - | 657 | WP_000100258.1 | carbon-nitrogen hydrolase family protein | - |
| K4F82_RS10155 | 2099643..2099873 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| K4F82_RS10160 | 2100011..2100385 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| K4F82_RS10165 | 2100386..2101261 | + | 876 | WP_000979702.1 | copper homeostasis membrane protein CopD | - |
| K4F82_RS10170 | 2101278..2101631 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2101731..2101876 | - | 146 | - | - | Antitoxin |
| - | 2101771..2101874 | + | 104 | - | - | Toxin |
| K4F82_RS10175 | 2102005..2102928 | - | 924 | Protein_1997 | tyrosine-type recombinase/integrase | - |
| K4F82_RS24270 | 2103192..2103653 | - | 462 | Protein_1998 | DNA breaking-rejoining protein | - |
| K4F82_RS10185 | 2103642..2103833 | + | 192 | Protein_1999 | glycoside hydrolase family 19 protein | - |
| K4F82_RS10190 | 2103887..2104420 | + | 534 | WP_001050882.1 | DUF2514 domain-containing protein | - |
| K4F82_RS10195 | 2104677..2104844 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| K4F82_RS10200 | 2104909..2105097 | - | 189 | WP_001521334.1 | hypothetical protein | - |
| K4F82_RS10205 | 2105152..2105412 | + | 261 | Protein_2003 | DUF1441 family protein | - |
| K4F82_RS10210 | 2105627..2105971 | + | 345 | Protein_2004 | macro domain-containing protein | - |
| K4F82_RS10215 | 2105981..2106451 | + | 471 | Protein_2005 | tail fiber assembly protein | - |
| K4F82_RS10220 | 2106548..2106748 | - | 201 | WP_010989029.1 | PagK family vesicle-borne virulence factor | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| inside | Prophage | - | sopE2 | 2079863..2134388 | 54525 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T212651 NZ_CP081187:2101771-2101874 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT212651 NZ_CP081187:c2101876-2101731 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
