Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2059984..2060129 | Replicon | chromosome |
Accession | NZ_CP077704 | ||
Organism | Salmonella enterica subsp. enterica strain CFSAN058565 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2060024..2060127 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2059984..2060129 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
DBO17_RS09935 | 2056410..2057108 | - | 699 | WP_000944284.1 | exodeoxyribonuclease X | - |
DBO17_RS09940 | 2057132..2057788 | - | 657 | WP_000100256.1 | nitrilase-related carbon-nitrogen hydrolase | - |
DBO17_RS09945 | 2057896..2058126 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
DBO17_RS09950 | 2058264..2058638 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
DBO17_RS09955 | 2058639..2059514 | + | 876 | WP_000979694.1 | copper homeostasis membrane protein CopD | - |
DBO17_RS09960 | 2059531..2059884 | + | 354 | WP_000722367.1 | YebY family protein | - |
- | 2059984..2060129 | - | 146 | - | - | Antitoxin |
- | 2060024..2060127 | + | 104 | - | - | Toxin |
DBO17_RS09965 | 2060267..2061346 | - | 1080 | WP_038803962.1 | phage integrase Arm DNA-binding domain-containing protein | - |
DBO17_RS09970 | 2061379..2062530 | - | 1152 | Protein_1959 | PD-(D/E)XK nuclease-like domain-containing protein | - |
DBO17_RS09975 | 2062519..2062710 | + | 192 | Protein_1960 | glycoside hydrolase family 19 protein | - |
DBO17_RS09980 | 2062764..2063297 | + | 534 | WP_001050883.1 | DUF2514 domain-containing protein | - |
DBO17_RS09985 | 2063554..2063721 | - | 168 | WP_000789530.1 | lytic enzyme | - |
DBO17_RS09990 | 2064029..2064289 | + | 261 | Protein_1963 | DUF1441 family protein | - |
DBO17_RS24065 | 2064291..2064506 | + | 216 | Protein_1964 | shikimate transporter | - |
DBO17_RS09995 | 2064504..2064848 | + | 345 | Protein_1965 | macro domain-containing protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
inside | Prophage | - | sopE2 | 2054322..2092246 | 37924 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T207586 NZ_CP077704:2060024-2060127 [Salmonella enterica subsp. enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT207586 NZ_CP077704:c2060129-2059984 [Salmonella enterica subsp. enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG