Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 1984785..1984930 | Replicon | chromosome |
| Accession | NZ_CP075141 | ||
| Organism | Salmonella enterica strain CFSAN033950 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 1984825..1984928 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 1984785..1984930 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| ACV97_RS09420 | 1981211..1981909 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
| ACV97_RS09425 | 1981933..1982589 | - | 657 | WP_000100258.1 | carbon-nitrogen hydrolase family protein | - |
| ACV97_RS09430 | 1982697..1982927 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| ACV97_RS09435 | 1983065..1983439 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| ACV97_RS09440 | 1983440..1984315 | + | 876 | WP_000979702.1 | copper homeostasis membrane protein CopD | - |
| ACV97_RS09445 | 1984332..1984685 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 1984785..1984930 | - | 146 | - | - | Antitoxin |
| - | 1984825..1984928 | + | 104 | - | - | Toxin |
| ACV97_RS09450 | 1985059..1985982 | - | 924 | Protein_1849 | tyrosine-type recombinase/integrase | - |
| ACV97_RS24120 | 1986246..1986707 | - | 462 | Protein_1850 | DNA breaking-rejoining protein | - |
| ACV97_RS09460 | 1986696..1986887 | + | 192 | Protein_1851 | glycoside hydrolase family 19 protein | - |
| ACV97_RS09465 | 1986941..1987474 | + | 534 | WP_001050882.1 | DUF2514 domain-containing protein | - |
| ACV97_RS09470 | 1987731..1987898 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| ACV97_RS09475 | 1987963..1988151 | - | 189 | WP_001521334.1 | hypothetical protein | - |
| ACV97_RS09480 | 1988206..1988466 | + | 261 | Protein_1855 | DUF1441 family protein | - |
| ACV97_RS24125 | 1988468..1988683 | + | 216 | Protein_1856 | shikimate transporter | - |
| ACV97_RS09485 | 1988681..1989025 | + | 345 | Protein_1857 | macro domain-containing protein | - |
| ACV97_RS09490 | 1989035..1989505 | + | 471 | Protein_1858 | tail fiber assembly protein | - |
| ACV97_RS09495 | 1989602..1989802 | - | 201 | WP_010989029.1 | PagK family vesicle-borne virulence factor | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| inside | Prophage | - | sopE2 | 1962917..2017434 | 54517 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T203276 NZ_CP075141:1984825-1984928 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT203276 NZ_CP075141:c1984930-1984785 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
