Detailed information of TA system    

insolicoBioinformatically predicted

Overview

TA module


Type VIII Classification (family/domain) SdsR-RyeA/-
Location 2117014..2117159 Replicon chromosome
Accession NZ_CP074663
Organism Salmonella enterica subsp. enterica serovar Typhimurium strain CFSAN008081

Toxin (RNA)


Gene name SdsR
Locus tag -
Coordinates 2117054..2117157 (+)

Antitoxin (RNA)


Gene name RyeA
Locus tag -
Coordinates 2117014..2117159 (-)

Genomic Context

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
BG493_RS10260 2113440..2114138 - 699 WP_000944282.1 exodeoxyribonuclease X -
BG493_RS10265 2114162..2114818 - 657 WP_000100258.1 carbon-nitrogen hydrolase family protein -
BG493_RS10270 2114926..2115156 - 231 WP_000856224.1 DNA polymerase III subunit theta -
BG493_RS10275 2115294..2115668 + 375 WP_000168393.1 CopC domain-containing protein YobA -
BG493_RS10280 2115669..2116544 + 876 WP_000979702.1 copper homeostasis membrane protein CopD -
BG493_RS10285 2116561..2116914 + 354 WP_000722368.1 YebY family protein -
- 2117014..2117159 - 146 - - Antitoxin
- 2117054..2117157 + 104 - - Toxin
BG493_RS10290 2117288..2118211 - 924 Protein_2022 tyrosine-type recombinase/integrase -
BG493_RS24205 2118475..2118936 - 462 Protein_2023 DNA breaking-rejoining protein -
BG493_RS10300 2118925..2119116 + 192 Protein_2024 glycoside hydrolase family 19 protein -
BG493_RS10305 2119170..2119703 + 534 WP_001050882.1 DUF2514 domain-containing protein -
BG493_RS10310 2119960..2120127 - 168 WP_000789530.1 lytic enzyme -
BG493_RS10315 2120192..2120380 - 189 WP_001521334.1 hypothetical protein -
BG493_RS10320 2120435..2120695 + 261 Protein_2028 DUF1441 family protein -
BG493_RS10325 2120910..2121254 + 345 Protein_2029 macro domain-containing protein -
BG493_RS10330 2121264..2121734 + 471 Protein_2030 tail fiber assembly protein -
BG493_RS10335 2121831..2122031 - 201 WP_010989029.1 PagK family vesicle-borne virulence factor -

Associated MGEs

MGE
detail		 Similar
MGEs		 Relative
position		 MGE Type Cargo ARG Virulence gene Coordinates Length (bp)
inside Prophage - sopE2 2095146..2149656 54510


Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.


Sequences

Toxin        


Download         Length: 104 bp

>T202570 NZ_CP074663:2117054-2117157 [Salmonella enterica subsp. enterica serovar Typhimurium]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT

Antitoxin


Download         Length: 146 bp

>AT202570 NZ_CP074663:c2117159-2117014 [Salmonella enterica subsp. enterica serovar Typhimurium]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG

Structures

Antitoxin

Download structure file

Antitoxin

Download structure file

References