Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2117014..2117159 | Replicon | chromosome |
| Accession | NZ_CP074663 | ||
| Organism | Salmonella enterica subsp. enterica serovar Typhimurium strain CFSAN008081 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2117054..2117157 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2117014..2117159 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| BG493_RS10260 | 2113440..2114138 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
| BG493_RS10265 | 2114162..2114818 | - | 657 | WP_000100258.1 | carbon-nitrogen hydrolase family protein | - |
| BG493_RS10270 | 2114926..2115156 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| BG493_RS10275 | 2115294..2115668 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| BG493_RS10280 | 2115669..2116544 | + | 876 | WP_000979702.1 | copper homeostasis membrane protein CopD | - |
| BG493_RS10285 | 2116561..2116914 | + | 354 | WP_000722368.1 | YebY family protein | - |
| BG493_RS10290 | 2117288..2118211 | - | 924 | Protein_2022 | tyrosine-type recombinase/integrase | - |
| BG493_RS24205 | 2118475..2118936 | - | 462 | Protein_2023 | DNA breaking-rejoining protein | - |
| BG493_RS10300 | 2118925..2119116 | + | 192 | Protein_2024 | glycoside hydrolase family 19 protein | - |
| BG493_RS10305 | 2119170..2119703 | + | 534 | WP_001050882.1 | DUF2514 domain-containing protein | - |
| BG493_RS10310 | 2119960..2120127 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| BG493_RS10315 | 2120192..2120380 | - | 189 | WP_001521334.1 | hypothetical protein | - |
| BG493_RS10320 | 2120435..2120695 | + | 261 | Protein_2028 | DUF1441 family protein | - |
| BG493_RS10325 | 2120910..2121254 | + | 345 | Protein_2029 | macro domain-containing protein | - |
| BG493_RS10330 | 2121264..2121734 | + | 471 | Protein_2030 | tail fiber assembly protein | - |
| BG493_RS10335 | 2121831..2122031 | - | 201 | WP_010989029.1 | PagK family vesicle-borne virulence factor | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| inside | Prophage | - | sopE2 | 2095146..2149656 | 54510 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T202570 NZ_CP074663:2117054-2117157 [Salmonella enterica subsp. enterica serovar Typhimurium]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT202570 NZ_CP074663:c2117159-2117014 [Salmonella enterica subsp. enterica serovar Typhimurium]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG