Detailed information of TA system    

insolicoBioinformatically predicted

Overview

TA module


Type VIII Classification (family/domain) SdsR-RyeA/-
Location 1968275..1968418 Replicon chromosome
Accession NZ_CP074098
Organism Salmonella enterica subsp. enterica serovar Typhimurium strain C_cip

Toxin (RNA)


Gene name SdsR
Locus tag -
Coordinates 1968277..1968380 (-)

Antitoxin (RNA)


Gene name RyeA
Locus tag -
Coordinates 1968275..1968418 (+)

Genomic Context

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
KFV01_RS09585 1963403..1963603 + 201 WP_010989029.1 PagK family vesicle-borne virulence factor -
KFV01_RS09590 1963700..1964170 - 471 Protein_1884 tail fiber assembly protein -
KFV01_RS09595 1964180..1964524 - 345 Protein_1885 macro domain-containing protein -
KFV01_RS09600 1964739..1964999 - 261 Protein_1886 DUF1441 family protein -
KFV01_RS09605 1965307..1965474 + 168 WP_000789530.1 lytic enzyme -
KFV01_RS09610 1965731..1966264 - 534 WP_001050882.1 DUF2514 domain-containing protein -
KFV01_RS09615 1966318..1966509 - 192 Protein_1889 glycoside hydrolase family 19 protein -
KFV01_RS24100 1966498..1966959 + 462 Protein_1890 DNA breaking-rejoining protein -
KFV01_RS09625 1967223..1968146 + 924 Protein_1891 tyrosine-type recombinase/integrase -
- 1968275..1968418 + 144 - - Antitoxin
- 1968277..1968380 - 104 - - Toxin
KFV01_RS09630 1968520..1968873 - 354 WP_000722368.1 YebY family protein -
KFV01_RS09635 1968890..1969765 - 876 WP_023223935.1 copper homeostasis membrane protein CopD -
KFV01_RS09640 1969766..1970140 - 375 WP_023205606.1 CopC domain-containing protein YobA -
KFV01_RS09645 1970278..1970508 + 231 WP_000856224.1 DNA polymerase III subunit theta -
KFV01_RS09650 1970616..1971272 + 657 WP_000100249.1 carbon-nitrogen hydrolase family protein -
KFV01_RS09655 1971296..1971994 + 699 WP_000944282.1 exodeoxyribonuclease X -

Associated MGEs

MGE
detail		 Similar
MGEs		 Relative
position		 MGE Type Cargo ARG Virulence gene Coordinates Length (bp)
inside Prophage - sopE2 1935763..1974080 38317


Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.


Sequences

Toxin        


Download         Length: 104 bp

>T201441 NZ_CP074098:c1968380-1968277 [Salmonella enterica subsp. enterica serovar Typhimurium]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT

Antitoxin


Download         Length: 144 bp

>AT201441 NZ_CP074098:1968275-1968418 [Salmonella enterica subsp. enterica serovar Typhimurium]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG

Structures

Antitoxin

Download structure file

Antitoxin

Download structure file

References