Detailed information of TA system    

insolicoBioinformatically predicted

Overview

TA module


Type VIII Classification (family/domain) SdsR-RyeA/-
Location 1968216..1968359 Replicon chromosome
Accession NZ_CP074096
Organism Salmonella enterica subsp. enterica serovar Typhimurium strain 2B_cip

Toxin (RNA)


Gene name SdsR
Locus tag -
Coordinates 1968218..1968321 (-)

Antitoxin (RNA)


Gene name RyeA
Locus tag -
Coordinates 1968216..1968359 (+)

Genomic Context

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
KFV00_RS09585 1963344..1963544 + 201 WP_010989029.1 PagK family vesicle-borne virulence factor -
KFV00_RS09590 1963641..1964111 - 471 Protein_1884 tail fiber assembly protein -
KFV00_RS09595 1964121..1964465 - 345 Protein_1885 macro domain-containing protein -
KFV00_RS09600 1964680..1964940 - 261 Protein_1886 DUF1441 family protein -
KFV00_RS09605 1965248..1965415 + 168 WP_000789530.1 lytic enzyme -
KFV00_RS09610 1965672..1966205 - 534 WP_001050882.1 DUF2514 domain-containing protein -
KFV00_RS09615 1966259..1966450 - 192 Protein_1889 glycoside hydrolase family 19 protein -
KFV00_RS24100 1966439..1966900 + 462 Protein_1890 DNA breaking-rejoining protein -
KFV00_RS09625 1967164..1968087 + 924 Protein_1891 tyrosine-type recombinase/integrase -
- 1968216..1968359 + 144 - - Antitoxin
- 1968218..1968321 - 104 - - Toxin
KFV00_RS09630 1968461..1968814 - 354 WP_000722368.1 YebY family protein -
KFV00_RS09635 1968831..1969706 - 876 WP_023223935.1 copper homeostasis membrane protein CopD -
KFV00_RS09640 1969707..1970081 - 375 WP_023205606.1 CopC domain-containing protein YobA -
KFV00_RS09645 1970219..1970449 + 231 WP_000856224.1 DNA polymerase III subunit theta -
KFV00_RS09650 1970557..1971213 + 657 WP_000100249.1 carbon-nitrogen hydrolase family protein -
KFV00_RS09655 1971237..1971935 + 699 WP_000944282.1 exodeoxyribonuclease X -

Associated MGEs

MGE
detail		 Similar
MGEs		 Relative
position		 MGE Type Cargo ARG Virulence gene Coordinates Length (bp)
inside Prophage - sopE2 1935712..1975698 39986


Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.


Sequences

Toxin        


Download         Length: 104 bp

>T201417 NZ_CP074096:c1968321-1968218 [Salmonella enterica subsp. enterica serovar Typhimurium]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT

Antitoxin


Download         Length: 144 bp

>AT201417 NZ_CP074096:1968216-1968359 [Salmonella enterica subsp. enterica serovar Typhimurium]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG

Structures

Antitoxin

Download structure file

Antitoxin

Download structure file

References