Detailed information of TA system    

insolicoBioinformatically predicted

Overview

TA module


Type VIII Classification (family/domain) SdsR-RyeA/-
Location 1968202..1968345 Replicon chromosome
Accession NZ_CP074094
Organism Salmonella enterica subsp. enterica serovar Typhimurium strain A_cip

Toxin (RNA)


Gene name SdsR
Locus tag -
Coordinates 1968204..1968307 (-)

Antitoxin (RNA)


Gene name RyeA
Locus tag -
Coordinates 1968202..1968345 (+)

Genomic Context

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
KFU99_RS09585 1963330..1963530 + 201 WP_010989029.1 PagK family vesicle-borne virulence factor -
KFU99_RS09590 1963627..1964097 - 471 Protein_1884 tail fiber assembly protein -
KFU99_RS09595 1964107..1964451 - 345 Protein_1885 macro domain-containing protein -
KFU99_RS09600 1964666..1964926 - 261 Protein_1886 DUF1441 family protein -
KFU99_RS09605 1965234..1965401 + 168 WP_000789530.1 lytic enzyme -
KFU99_RS09610 1965658..1966191 - 534 WP_001050882.1 DUF2514 domain-containing protein -
KFU99_RS09615 1966245..1966436 - 192 Protein_1889 glycoside hydrolase family 19 protein -
KFU99_RS24100 1966425..1966886 + 462 Protein_1890 DNA breaking-rejoining protein -
KFU99_RS09625 1967150..1968073 + 924 Protein_1891 tyrosine-type recombinase/integrase -
- 1968202..1968345 + 144 - - Antitoxin
- 1968204..1968307 - 104 - - Toxin
KFU99_RS09630 1968447..1968800 - 354 WP_000722368.1 YebY family protein -
KFU99_RS09635 1968817..1969692 - 876 WP_023223935.1 copper homeostasis membrane protein CopD -
KFU99_RS09640 1969693..1970067 - 375 WP_023205606.1 CopC domain-containing protein YobA -
KFU99_RS09645 1970205..1970435 + 231 WP_000856224.1 DNA polymerase III subunit theta -
KFU99_RS09650 1970543..1971199 + 657 WP_000100249.1 carbon-nitrogen hydrolase family protein -
KFU99_RS09655 1971223..1971921 + 699 WP_000944282.1 exodeoxyribonuclease X -

Associated MGEs

MGE
detail		 Similar
MGEs		 Relative
position		 MGE Type Cargo ARG Virulence gene Coordinates Length (bp)
inside Prophage - sopE2 1935698..1974007 38309


Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.


Sequences

Toxin        


Download         Length: 104 bp

>T201393 NZ_CP074094:c1968307-1968204 [Salmonella enterica subsp. enterica serovar Typhimurium]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT

Antitoxin


Download         Length: 144 bp

>AT201393 NZ_CP074094:1968202-1968345 [Salmonella enterica subsp. enterica serovar Typhimurium]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG

Structures

Antitoxin

Download structure file

Antitoxin

Download structure file

References