Detailed information of TA system    

insolicoBioinformatically predicted

Overview

TA module


Type VIII Classification (family/domain) SdsR-RyeA/-
Location 2634737..2634882 Replicon chromosome
Accession NZ_CP068018
Organism Salmonella enterica strain 1722

Toxin (RNA)


Gene name SdsR
Locus tag -
Coordinates 2634739..2634842 (-)

Antitoxin (RNA)


Gene name RyeA
Locus tag -
Coordinates 2634737..2634882 (+)

Genomic Context

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
JI996_RS12985 2629865..2630065 + 201 WP_010989029.1 PagK family vesicle-borne virulence factor -
JI996_RS12990 2630162..2630632 - 471 Protein_2535 tail fiber assembly protein -
JI996_RS12995 2630642..2630986 - 345 Protein_2536 macro domain-containing protein -
JI996_RS13000 2631201..2631461 - 261 Protein_2537 DUF1441 family protein -
JI996_RS13005 2631516..2631704 + 189 WP_001521334.1 hypothetical protein -
JI996_RS13010 2631769..2631936 + 168 WP_000789530.1 lytic enzyme -
JI996_RS13015 2632193..2632726 - 534 WP_001050882.1 DUF2514 domain-containing protein -
JI996_RS13020 2632780..2632971 - 192 Protein_2541 glycoside hydrolase family 19 protein -
JI996_RS13025 2632960..2633421 + 462 Protein_2542 DNA breaking-rejoining protein -
JI996_RS13030 2633685..2634608 + 924 Protein_2543 tyrosine-type recombinase/integrase -
- 2634737..2634882 + 146 - - Antitoxin
- 2634739..2634842 - 104 - - Toxin
JI996_RS13035 2634982..2635335 - 354 WP_000722368.1 YebY family protein -
JI996_RS13040 2635352..2636227 - 876 WP_000979702.1 copper homeostasis membrane protein CopD -
JI996_RS13045 2636228..2636602 - 375 WP_000168393.1 CopC domain-containing protein YobA -
JI996_RS13050 2636740..2636970 + 231 WP_000856224.1 DNA polymerase III subunit theta -
JI996_RS13055 2637078..2637734 + 657 WP_000100258.1 carbon-nitrogen hydrolase family protein -
JI996_RS13060 2637758..2638456 + 699 WP_000944282.1 exodeoxyribonuclease X -

Associated MGEs

MGE
detail		 Similar
MGEs		 Relative
position		 MGE Type Cargo ARG Virulence gene Coordinates Length (bp)
inside Prophage - sopE2 2602225..2656750 54525


Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.


Sequences

Toxin        


Download         Length: 104 bp

>T186441 NZ_CP068018:c2634842-2634739 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT

Antitoxin


Download         Length: 146 bp

>AT186441 NZ_CP068018:2634737-2634882 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG

Structures

Antitoxin

Download structure file

Antitoxin

Download structure file

References