Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2852004..2852149 | Replicon | chromosome |
| Accession | NZ_CP047553 | ||
| Organism | Salmonella enterica subsp. enterica serovar Typhimurium strain SJTUF10231 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2852006..2852109 (-) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2852004..2852149 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| DXN27_RS13920 | 2847132..2847332 | + | 201 | WP_010989029.1 | PagK family vesicle-borne virulence factor | - |
| DXN27_RS13925 | 2847429..2847899 | - | 471 | Protein_2706 | tail fiber assembly protein | - |
| DXN27_RS13930 | 2847909..2848253 | - | 345 | Protein_2707 | macro domain-containing protein | - |
| DXN27_RS13935 | 2848468..2848728 | - | 261 | Protein_2708 | DUF1441 family protein | - |
| DXN27_RS13940 | 2848783..2848971 | + | 189 | WP_001521334.1 | hypothetical protein | - |
| DXN27_RS13945 | 2849036..2849203 | + | 168 | WP_000789530.1 | lytic enzyme | - |
| DXN27_RS13950 | 2849460..2849993 | - | 534 | WP_001050882.1 | DUF2514 domain-containing protein | - |
| DXN27_RS13955 | 2850047..2850238 | - | 192 | Protein_2712 | glycoside hydrolase family 19 protein | - |
| DXN27_RS13960 | 2850227..2850688 | + | 462 | Protein_2713 | DNA breaking-rejoining protein | - |
| DXN27_RS13965 | 2850952..2851875 | + | 924 | Protein_2714 | tyrosine-type recombinase/integrase | - |
| - | 2852004..2852149 | + | 146 | - | - | Antitoxin |
| - | 2852006..2852109 | - | 104 | - | - | Toxin |
| DXN27_RS13970 | 2852249..2852602 | - | 354 | WP_000722368.1 | YebY family protein | - |
| DXN27_RS13975 | 2852619..2853494 | - | 876 | WP_000979702.1 | copper homeostasis membrane protein CopD | - |
| DXN27_RS13980 | 2853495..2853869 | - | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| DXN27_RS13985 | 2854007..2854237 | + | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| DXN27_RS13990 | 2854345..2855001 | + | 657 | WP_000100258.1 | carbon-nitrogen hydrolase family protein | - |
| DXN27_RS13995 | 2855025..2855723 | + | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| inside | Prophage | - | sopE2 | 2819492..2874017 | 54525 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T146672 NZ_CP047553:c2852109-2852006 [Salmonella enterica subsp. enterica serovar Typhimurium]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT146672 NZ_CP047553:2852004-2852149 [Salmonella enterica subsp. enterica serovar Typhimurium]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG