Detailed information of TA system    

insolicoBioinformatically predicted

Overview

TA module


Type VIII Classification (family/domain) SdsR-RyeA/-
Location 2174850..2174995 Replicon chromosome
Accession NZ_CP047544
Organism Salmonella enterica subsp. enterica serovar Typhimurium strain SJTUF10250

Toxin (RNA)


Gene name SdsR
Locus tag -
Coordinates 2174890..2174993 (+)

Antitoxin (RNA)


Gene name RyeA
Locus tag -
Coordinates 2174850..2174995 (-)

Genomic Context

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
DXN29_RS10650 2171276..2171974 - 699 WP_000944282.1 exodeoxyribonuclease X -
DXN29_RS10655 2171998..2172654 - 657 WP_000100258.1 carbon-nitrogen hydrolase family protein -
DXN29_RS10660 2172762..2172992 - 231 WP_000856224.1 DNA polymerase III subunit theta -
DXN29_RS10665 2173130..2173504 + 375 WP_000168393.1 CopC domain-containing protein YobA -
DXN29_RS10670 2173505..2174380 + 876 WP_000979702.1 copper homeostasis membrane protein CopD -
DXN29_RS10675 2174397..2174750 + 354 WP_000722368.1 YebY family protein -
- 2174850..2174995 - 146 - - Antitoxin
- 2174890..2174993 + 104 - - Toxin
DXN29_RS10680 2175124..2176047 - 924 Protein_2095 tyrosine-type recombinase/integrase -
DXN29_RS10685 2176311..2176772 - 462 Protein_2096 DNA breaking-rejoining protein -
DXN29_RS10690 2176761..2176952 + 192 Protein_2097 glycoside hydrolase family 19 protein -
DXN29_RS10695 2177006..2177539 + 534 WP_001050882.1 DUF2514 domain-containing protein -
DXN29_RS10700 2177796..2177963 - 168 WP_000789530.1 lytic enzyme -
DXN29_RS10705 2178028..2178216 - 189 WP_001521334.1 hypothetical protein -
DXN29_RS10710 2178271..2178531 + 261 Protein_2101 DUF1441 family protein -
DXN29_RS10715 2178746..2179090 + 345 Protein_2102 macro domain-containing protein -
DXN29_RS10720 2179100..2179570 + 471 Protein_2103 tail fiber assembly protein -
DXN29_RS10725 2179667..2179867 - 201 WP_010989029.1 PagK family vesicle-borne virulence factor -

Associated MGEs

MGE
detail		 Similar
MGEs		 Relative
position		 MGE Type Cargo ARG Virulence gene Coordinates Length (bp)
inside Prophage - sopE2 2152982..2207507 54525


Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.


Sequences

Toxin        


Download         Length: 104 bp

>T146568 NZ_CP047544:2174890-2174993 [Salmonella enterica subsp. enterica serovar Typhimurium]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT

Antitoxin


Download         Length: 146 bp

>AT146568 NZ_CP047544:c2174995-2174850 [Salmonella enterica subsp. enterica serovar Typhimurium]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG

Structures

Antitoxin

Download structure file

Antitoxin

Download structure file

References