Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2174850..2174995 | Replicon | chromosome |
| Accession | NZ_CP047544 | ||
| Organism | Salmonella enterica subsp. enterica serovar Typhimurium strain SJTUF10250 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2174890..2174993 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2174850..2174995 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| DXN29_RS10650 | 2171276..2171974 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
| DXN29_RS10655 | 2171998..2172654 | - | 657 | WP_000100258.1 | carbon-nitrogen hydrolase family protein | - |
| DXN29_RS10660 | 2172762..2172992 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| DXN29_RS10665 | 2173130..2173504 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| DXN29_RS10670 | 2173505..2174380 | + | 876 | WP_000979702.1 | copper homeostasis membrane protein CopD | - |
| DXN29_RS10675 | 2174397..2174750 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2174850..2174995 | - | 146 | - | - | Antitoxin |
| - | 2174890..2174993 | + | 104 | - | - | Toxin |
| DXN29_RS10680 | 2175124..2176047 | - | 924 | Protein_2095 | tyrosine-type recombinase/integrase | - |
| DXN29_RS10685 | 2176311..2176772 | - | 462 | Protein_2096 | DNA breaking-rejoining protein | - |
| DXN29_RS10690 | 2176761..2176952 | + | 192 | Protein_2097 | glycoside hydrolase family 19 protein | - |
| DXN29_RS10695 | 2177006..2177539 | + | 534 | WP_001050882.1 | DUF2514 domain-containing protein | - |
| DXN29_RS10700 | 2177796..2177963 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| DXN29_RS10705 | 2178028..2178216 | - | 189 | WP_001521334.1 | hypothetical protein | - |
| DXN29_RS10710 | 2178271..2178531 | + | 261 | Protein_2101 | DUF1441 family protein | - |
| DXN29_RS10715 | 2178746..2179090 | + | 345 | Protein_2102 | macro domain-containing protein | - |
| DXN29_RS10720 | 2179100..2179570 | + | 471 | Protein_2103 | tail fiber assembly protein | - |
| DXN29_RS10725 | 2179667..2179867 | - | 201 | WP_010989029.1 | PagK family vesicle-borne virulence factor | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| inside | Prophage | - | sopE2 | 2152982..2207507 | 54525 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T146568 NZ_CP047544:2174890-2174993 [Salmonella enterica subsp. enterica serovar Typhimurium]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT146568 NZ_CP047544:c2174995-2174850 [Salmonella enterica subsp. enterica serovar Typhimurium]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG