Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2118159..2118304 | Replicon | chromosome |
| Accession | NZ_CP047540 | ||
| Organism | Salmonella enterica subsp. enterica serovar Typhimurium strain SJTUF10359 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2118199..2118302 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2118159..2118304 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| DXN31_RS10335 | 2114585..2115283 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
| DXN31_RS10340 | 2115307..2115963 | - | 657 | WP_000100258.1 | carbon-nitrogen hydrolase family protein | - |
| DXN31_RS10345 | 2116071..2116301 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| DXN31_RS10350 | 2116439..2116813 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| DXN31_RS10355 | 2116814..2117689 | + | 876 | WP_000979702.1 | copper homeostasis membrane protein CopD | - |
| DXN31_RS10360 | 2117706..2118059 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2118159..2118304 | - | 146 | - | - | Antitoxin |
| - | 2118199..2118302 | + | 104 | - | - | Toxin |
| DXN31_RS10365 | 2118433..2119356 | - | 924 | Protein_2032 | tyrosine-type recombinase/integrase | - |
| DXN31_RS10370 | 2119620..2120081 | - | 462 | Protein_2033 | DNA breaking-rejoining protein | - |
| DXN31_RS10375 | 2120070..2120261 | + | 192 | Protein_2034 | glycoside hydrolase family 19 protein | - |
| DXN31_RS10380 | 2120315..2120848 | + | 534 | WP_001050882.1 | DUF2514 domain-containing protein | - |
| DXN31_RS10385 | 2121105..2121272 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| DXN31_RS10390 | 2121337..2121525 | - | 189 | WP_001521334.1 | hypothetical protein | - |
| DXN31_RS10395 | 2121580..2121840 | + | 261 | Protein_2038 | DUF1441 family protein | - |
| DXN31_RS10400 | 2122055..2122399 | + | 345 | Protein_2039 | macro domain-containing protein | - |
| DXN31_RS10405 | 2122409..2122879 | + | 471 | Protein_2040 | tail fiber assembly protein | - |
| DXN31_RS10410 | 2122976..2123176 | - | 201 | WP_010989029.1 | PagK family vesicle-borne virulence factor | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| inside | Prophage | - | sopE2 | 2096291..2151592 | 55301 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T146518 NZ_CP047540:2118199-2118302 [Salmonella enterica subsp. enterica serovar Typhimurium]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT146518 NZ_CP047540:c2118304-2118159 [Salmonella enterica subsp. enterica serovar Typhimurium]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG