Detailed information of TA system    

insolicoBioinformatically predicted

Overview

TA module


Type VIII Classification (family/domain) SdsR-RyeA/-
Location 2118159..2118304 Replicon chromosome
Accession NZ_CP047540
Organism Salmonella enterica subsp. enterica serovar Typhimurium strain SJTUF10359

Toxin (RNA)


Gene name SdsR
Locus tag -
Coordinates 2118199..2118302 (+)

Antitoxin (RNA)


Gene name RyeA
Locus tag -
Coordinates 2118159..2118304 (-)

Genomic Context

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
DXN31_RS10335 2114585..2115283 - 699 WP_000944282.1 exodeoxyribonuclease X -
DXN31_RS10340 2115307..2115963 - 657 WP_000100258.1 carbon-nitrogen hydrolase family protein -
DXN31_RS10345 2116071..2116301 - 231 WP_000856224.1 DNA polymerase III subunit theta -
DXN31_RS10350 2116439..2116813 + 375 WP_000168393.1 CopC domain-containing protein YobA -
DXN31_RS10355 2116814..2117689 + 876 WP_000979702.1 copper homeostasis membrane protein CopD -
DXN31_RS10360 2117706..2118059 + 354 WP_000722368.1 YebY family protein -
- 2118159..2118304 - 146 - - Antitoxin
- 2118199..2118302 + 104 - - Toxin
DXN31_RS10365 2118433..2119356 - 924 Protein_2032 tyrosine-type recombinase/integrase -
DXN31_RS10370 2119620..2120081 - 462 Protein_2033 DNA breaking-rejoining protein -
DXN31_RS10375 2120070..2120261 + 192 Protein_2034 glycoside hydrolase family 19 protein -
DXN31_RS10380 2120315..2120848 + 534 WP_001050882.1 DUF2514 domain-containing protein -
DXN31_RS10385 2121105..2121272 - 168 WP_000789530.1 lytic enzyme -
DXN31_RS10390 2121337..2121525 - 189 WP_001521334.1 hypothetical protein -
DXN31_RS10395 2121580..2121840 + 261 Protein_2038 DUF1441 family protein -
DXN31_RS10400 2122055..2122399 + 345 Protein_2039 macro domain-containing protein -
DXN31_RS10405 2122409..2122879 + 471 Protein_2040 tail fiber assembly protein -
DXN31_RS10410 2122976..2123176 - 201 WP_010989029.1 PagK family vesicle-borne virulence factor -

Associated MGEs

MGE
detail		 Similar
MGEs		 Relative
position		 MGE Type Cargo ARG Virulence gene Coordinates Length (bp)
inside Prophage - sopE2 2096291..2151592 55301


Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.


Sequences

Toxin        


Download         Length: 104 bp

>T146518 NZ_CP047540:2118199-2118302 [Salmonella enterica subsp. enterica serovar Typhimurium]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT

Antitoxin


Download         Length: 146 bp

>AT146518 NZ_CP047540:c2118304-2118159 [Salmonella enterica subsp. enterica serovar Typhimurium]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG

Structures

Antitoxin

Download structure file

Antitoxin

Download structure file

References