Detailed information of TA system    

insolicoBioinformatically predicted

Overview

TA module


Type VIII Classification (family/domain) SdsR-RyeA/-
Location 2865220..2865365 Replicon chromosome
Accession NZ_CP047529
Organism Salmonella enterica subsp. enterica serovar Typhimurium strain SJTUF10640

Toxin (RNA)


Gene name SdsR
Locus tag -
Coordinates 2865222..2865325 (-)

Antitoxin (RNA)


Gene name RyeA
Locus tag -
Coordinates 2865220..2865365 (+)

Genomic Context

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
DXN10_RS13985 2860348..2860548 + 201 WP_010989029.1 PagK family vesicle-borne virulence factor -
DXN10_RS13990 2860645..2861115 - 471 Protein_2718 tail fiber assembly protein -
DXN10_RS13995 2861125..2861469 - 345 Protein_2719 macro domain-containing protein -
DXN10_RS14000 2861684..2861944 - 261 Protein_2720 DUF1441 family protein -
DXN10_RS14005 2861999..2862187 + 189 WP_001521334.1 hypothetical protein -
DXN10_RS14010 2862252..2862419 + 168 WP_000789530.1 lytic enzyme -
DXN10_RS14015 2862676..2863209 - 534 WP_001050882.1 DUF2514 domain-containing protein -
DXN10_RS14020 2863263..2863454 - 192 Protein_2724 glycoside hydrolase family 19 protein -
DXN10_RS14025 2863443..2863904 + 462 Protein_2725 DNA breaking-rejoining protein -
DXN10_RS14030 2864168..2865091 + 924 Protein_2726 tyrosine-type recombinase/integrase -
- 2865220..2865365 + 146 - - Antitoxin
- 2865222..2865325 - 104 - - Toxin
DXN10_RS14035 2865465..2865818 - 354 WP_000722368.1 YebY family protein -
DXN10_RS14040 2865835..2866710 - 876 WP_000979702.1 copper homeostasis membrane protein CopD -
DXN10_RS14045 2866711..2867085 - 375 WP_000168393.1 CopC domain-containing protein YobA -
DXN10_RS14050 2867223..2867453 + 231 WP_000856224.1 DNA polymerase III subunit theta -
DXN10_RS14055 2867561..2868217 + 657 WP_000100258.1 carbon-nitrogen hydrolase family protein -
DXN10_RS14060 2868241..2868939 + 699 WP_000944282.1 exodeoxyribonuclease X -

Associated MGEs

MGE
detail		 Similar
MGEs		 Relative
position		 MGE Type Cargo ARG Virulence gene Coordinates Length (bp)
inside Prophage - sopE2 2832708..2887233 54525


Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.


Sequences

Toxin        


Download         Length: 104 bp

>T146417 NZ_CP047529:c2865325-2865222 [Salmonella enterica subsp. enterica serovar Typhimurium]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT

Antitoxin


Download         Length: 146 bp

>AT146417 NZ_CP047529:2865220-2865365 [Salmonella enterica subsp. enterica serovar Typhimurium]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG

Structures

Antitoxin

Download structure file

Antitoxin

Download structure file

References