Detailed information of TA system
Overview
TA module
| Type | I | Classification (family/domain) | fst-RNAII/- |
| Location | 55498..55683 | Replicon | plasmid pTEF2 |
| Accession | NC_004671 | ||
| Organism | Enterococcus faecalis V583 | ||
| T1TAdb ID | TA04743 | ||
Toxin (Protein)
| Gene name | fst | Uniprot ID | - |
| Locus tag | EF_RS16055 | Protein ID | - |
| Coordinates | 55498..55569 (+) | Length | 24 a.a. |
Antitoxin (RNA)
| Gene name | RNAII | ||
| Locus tag | - | ||
| Coordinates | 55618..55683 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| EF_RS16040 (EF_B0059) | 50985..52877 | + | 1893 | WP_002406535.1 | DUF262 domain-containing protein | - |
| EF_RS16045 (EF_B0060) | 53404..54720 | + | 1317 | WP_002406534.1 | Y-family DNA polymerase | - |
| EF_RS16050 (EF_B0061) | 54725..55231 | + | 507 | WP_010774282.1 | hypothetical protein | - |
| - | 55498..55569 | + | 72 | - | - | Toxin |
| - | 55618..55683 | - | 66 | - | - | Antitoxin |
| EF_RS16060 (EF_B0063) | 55819..56115 | + | 297 | WP_002402704.1 | replication control protein PrgN | - |
| EF_RS16065 (EF_B0064) | 56369..57151 | + | 783 | WP_002369746.1 | ParA family protein | - |
| EF_RS16070 (EF_B0065) | 57144..57500 | + | 357 | WP_002360663.1 | hypothetical protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Non-Mobilizable plasmid | - | prgB/asc10 | 1..57660 | 57660 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 24 a.a. Molecular weight: 2579.14 Da Isoelectric Point: 3.8250
>T10028 NC_004671:55498-55569 [Enterococcus faecalis V583]
MSLVIAPLFVGLVILLVDHWLDD
MSLVIAPLFVGLVILLVDHWLDD
Download Length: 72 bp
>T10028 NC_004671:55498-55569 [Enterococcus faecalis V583]
ATGTCTTTGGTTATTGCCCCACTTTTTGTGGGTCTAGTAATCTTACTAGTTGACCATTGGTTAGATGATTAG
ATGTCTTTGGTTATTGCCCCACTTTTTGTGGGTCTAGTAATCTTACTAGTTGACCATTGGTTAGATGATTAG
Antitoxin
Download Length: 66 bp
>AT10028 NC_004671:c55683-55618 [Enterococcus faecalis V583]
AAGACATAAGTTCGATATGAACAGCACAATAGCCCAAACCTGTGACGAGGTTTGGGCTATTTTTTT
AAGACATAAGTTCGATATGAACAGCACAATAGCCCAAACCTGTGACGAGGTTTGGGCTATTTTTTT
Similar Proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|---|---|---|---|
| T6359 | Enterococcus faecalis |
60.87 |
100 |
0.609 |
| T10029 | Enterococcus faecalis V583 |
39.13 |
100 |
0.391 |
| T10024 | Staphylococcus aureus subsp. aureus str. Newman |
35 |
86.957 |
0.304 |
Multiple sequence alignment
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|
References
(1) T J Greenfield et al. (2001) Antisense RNA regulation of the par post-segregational killing system: structural analysis and mechanism of binding of the antisense RNA, RNAII and its target, RNAI. Molecular Microbiology 42(2):527-37. [PubMed:11703673]