Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   AAVB50_RS21845 Genome accession   NZ_CP154923
Coordinates   4089051..4089173 (-) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain FUA2233     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 4084051..4094173
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  AAVB50_RS21815 (AAVB50_21810) yclP 4084123..4084881 (-) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -
  AAVB50_RS21820 (AAVB50_21815) yclO 4084875..4085822 (-) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  AAVB50_RS21825 (AAVB50_21820) ceuB 4085815..4086765 (-) 951 WP_088325307.1 petrobactin ABC transporter permease YclN Machinery gene
  AAVB50_RS21830 (AAVB50_21825) thrD 4087150..4088514 (+) 1365 WP_224912752.1 aspartate kinase -
  AAVB50_RS21835 (AAVB50_21830) yczN 4088667..4088780 (+) 114 WP_003234495.1 YjcZ family sporulation protein -
  AAVB50_RS21840 (AAVB50_21835) yczM 4088862..4088951 (+) 90 WP_015482794.1 YjcZ family sporulation protein -
  AAVB50_RS21845 (AAVB50_21840) phrC 4089051..4089173 (-) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  AAVB50_RS21850 (AAVB50_21845) rapC 4089157..4090305 (-) 1149 WP_015252823.1 response regulator aspartate phosphatase RapC Regulator
  AAVB50_RS21855 (AAVB50_21850) yclK 4090468..4091889 (-) 1422 WP_220396634.1 two-component system sensor histidine kinase YclK -
  AAVB50_RS21860 (AAVB50_21855) yclJ 4091876..4092559 (-) 684 WP_003246532.1 two-component system response regulator YclJ -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=995570 AAVB50_RS21845 WP_003224994.1 4089051..4089173(-) (phrC) [Bacillus subtilis strain FUA2233]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=995570 AAVB50_RS21845 WP_003224994.1 4089051..4089173(-) (phrC) [Bacillus subtilis strain FUA2233]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment