Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   AAYR29_RS15325 Genome accession   NZ_CP154918
Coordinates   2843269..2843391 (-) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain FUA2231     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 2838269..2848391
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  AAYR29_RS15295 (AAYR29_15295) yclP 2838341..2839099 (-) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -
  AAYR29_RS15300 (AAYR29_15300) yclO 2839093..2840040 (-) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  AAYR29_RS15305 (AAYR29_15305) ceuB 2840033..2840983 (-) 951 WP_088325307.1 petrobactin ABC transporter permease YclN Machinery gene
  AAYR29_RS15310 (AAYR29_15310) thrD 2841368..2842732 (+) 1365 WP_224912752.1 aspartate kinase -
  AAYR29_RS15315 (AAYR29_15315) yczN 2842885..2842998 (+) 114 WP_003234495.1 YjcZ family sporulation protein -
  AAYR29_RS15320 (AAYR29_15320) yczM 2843080..2843169 (+) 90 WP_015482794.1 YjcZ family sporulation protein -
  AAYR29_RS15325 (AAYR29_15325) phrC 2843269..2843391 (-) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  AAYR29_RS15330 (AAYR29_15330) rapC 2843375..2844523 (-) 1149 WP_015252823.1 response regulator aspartate phosphatase RapC Regulator
  AAYR29_RS15335 (AAYR29_15335) yclK 2844686..2846107 (-) 1422 WP_220396634.1 two-component system sensor histidine kinase YclK -
  AAYR29_RS15340 (AAYR29_15340) yclJ 2846094..2846777 (-) 684 WP_003246532.1 two-component system response regulator YclJ -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=995393 AAYR29_RS15325 WP_003224994.1 2843269..2843391(-) (phrC) [Bacillus subtilis strain FUA2231]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=995393 AAYR29_RS15325 WP_003224994.1 2843269..2843391(-) (phrC) [Bacillus subtilis strain FUA2231]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment