Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   AAHT66_RS01075 Genome accession   NZ_CP154441
Coordinates   189610..189732 (-) Length   40 a.a.
NCBI ID   WP_087993038.1    Uniprot ID   -
Organism   Bacillus inaquosorum strain XN303     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 184610..194732
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  AAHT66_RS01045 (AAHT66_01045) yclP 184621..185379 (-) 759 WP_087993033.1 petrobactin ABC transporter ATP-binding protein YclP -
  AAHT66_RS01050 (AAHT66_01050) yclO 185373..186320 (-) 948 WP_333516777.1 petrobactin ABC transporter permease YclO -
  AAHT66_RS01055 (AAHT66_01055) ceuB 186313..187263 (-) 951 WP_087993035.1 petrobactin ABC transporter permease YclN Machinery gene
  AAHT66_RS01060 (AAHT66_01060) - 187650..189014 (+) 1365 WP_087993036.1 aspartate kinase -
  AAHT66_RS01065 (AAHT66_01065) - 189165..189278 (+) 114 WP_039075856.1 YjcZ family sporulation protein -
  AAHT66_RS01070 (AAHT66_01070) - 189415..189510 (+) 96 WP_087993037.1 YjcZ family sporulation protein -
  AAHT66_RS01075 (AAHT66_01075) phrC 189610..189732 (-) 123 WP_087993038.1 phosphatase RapC inhibitor PhrC Regulator
  AAHT66_RS01080 (AAHT66_01080) rapC 189716..190864 (-) 1149 WP_087993039.1 response regulator aspartate phosphatase RapC Regulator
  AAHT66_RS01085 (AAHT66_01085) - 191027..192442 (-) 1416 WP_087993040.1 sensor histidine kinase -
  AAHT66_RS01090 (AAHT66_01090) yclJ 192429..193112 (-) 684 WP_087993041.1 two-component system response regulator YclJ -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4167.96 Da        Isoelectric Point: 8.0285

>NTDB_id=993319 AAHT66_RS01075 WP_087993038.1 189610..189732(-) (phrC) [Bacillus inaquosorum strain XN303]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVAERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=993319 AAHT66_RS01075 WP_087993038.1 189610..189732(-) (phrC) [Bacillus inaquosorum strain XN303]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTAGCCGCGGCTGCAATTTTTACAGCGGCTGGCGTCTCAGCTAACGC
GGAAGCACTCGACTTTCATGTGGCGGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

97.5

100

0.975

Multiple sequence alignment