Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   NYE49_RS02120 Genome accession   NZ_CP151962
Coordinates   415451..415573 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus sp. FSL L8-0358     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 410451..420573
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  NYE49_RS02105 (NYE49_02105) yclJ 412065..412748 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  NYE49_RS02110 (NYE49_02110) yclK 412735..414156 (+) 1422 WP_080344153.1 two-component system sensor histidine kinase YclK -
  NYE49_RS02115 (NYE49_02115) rapC 414319..415467 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  NYE49_RS02120 (NYE49_02120) phrC 415451..415573 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  NYE49_RS02125 (NYE49_02125) - 415673..415762 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  NYE49_RS02130 (NYE49_02130) - 415846..415959 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  NYE49_RS02135 (NYE49_02135) - 416112..417476 (-) 1365 WP_342410880.1 aspartate kinase -
  NYE49_RS02140 (NYE49_02140) ceuB 417861..418811 (+) 951 WP_015382768.1 petrobactin ABC transporter permease YclN Machinery gene
  NYE49_RS02145 (NYE49_02145) yclO 418804..419751 (+) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  NYE49_RS02150 (NYE49_02150) yclP 419745..420503 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=982306 NYE49_RS02120 WP_003224994.1 415451..415573(+) (phrC) [Bacillus sp. FSL L8-0358]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=982306 NYE49_RS02120 WP_003224994.1 415451..415573(+) (phrC) [Bacillus sp. FSL L8-0358]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment