Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   NSU09_RS02145 Genome accession   NZ_CP151942
Coordinates   423058..423180 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus sp. PS194     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 418058..428180
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  NSU09_RS02130 (NSU09_02130) yclJ 419672..420355 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  NSU09_RS02135 (NSU09_02135) yclK 420342..421763 (+) 1422 WP_113713032.1 two-component system sensor histidine kinase YclK -
  NSU09_RS02140 (NSU09_02140) rapC 421926..423074 (+) 1149 WP_003246686.1 response regulator aspartate phosphatase RapC Regulator
  NSU09_RS02145 (NSU09_02145) phrC 423058..423180 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  NSU09_RS02150 (NSU09_02150) - 423280..423369 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  NSU09_RS02155 (NSU09_02155) - 423451..423564 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  NSU09_RS02160 (NSU09_02160) - 423718..425082 (-) 1365 WP_113713033.1 aspartate kinase -
  NSU09_RS02165 (NSU09_02165) ceuB 425467..426417 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  NSU09_RS02170 (NSU09_02170) yclO 426410..427357 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  NSU09_RS02175 (NSU09_02175) yclP 427351..428109 (+) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=981443 NSU09_RS02145 WP_003224994.1 423058..423180(+) (phrC) [Bacillus sp. PS194]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=981443 NSU09_RS02145 WP_003224994.1 423058..423180(+) (phrC) [Bacillus sp. PS194]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment