Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   MHH79_RS02145 Genome accession   NZ_CP150275
Coordinates   420692..420814 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus sp. FSL K6-0993     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 415692..425814
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  MHH79_RS02130 (MHH79_02130) yclJ 417306..417989 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  MHH79_RS02135 (MHH79_02135) yclK 417976..419397 (+) 1422 WP_340034965.1 two-component system sensor histidine kinase YclK -
  MHH79_RS02140 (MHH79_02140) rapC 419560..420708 (+) 1149 WP_015252823.1 response regulator aspartate phosphatase RapC Regulator
  MHH79_RS02145 (MHH79_02145) phrC 420692..420814 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  MHH79_RS02150 (MHH79_02150) - 420914..421003 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  MHH79_RS02155 (MHH79_02155) - 421087..421200 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  MHH79_RS02160 (MHH79_02160) - 421353..422717 (-) 1365 WP_340034966.1 aspartate kinase -
  MHH79_RS02165 (MHH79_02165) ceuB 423102..424052 (+) 951 WP_015382768.1 petrobactin ABC transporter permease YclN Machinery gene
  MHH79_RS02170 (MHH79_02170) yclO 424045..424992 (+) 948 WP_123372797.1 petrobactin ABC transporter permease YclO -
  MHH79_RS02175 (MHH79_02175) yclP 424986..425744 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=969079 MHH79_RS02145 WP_003224994.1 420692..420814(+) (phrC) [Bacillus sp. FSL K6-0993]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=969079 MHH79_RS02145 WP_003224994.1 420692..420814(+) (phrC) [Bacillus sp. FSL K6-0993]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1


Multiple sequence alignment