Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   MHI44_RS13745 Genome accession   NZ_CP150268
Coordinates   2631385..2631507 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus sp. FSL K6-1366     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 2626385..2636507
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  MHI44_RS13730 (MHI44_13730) yclJ 2627998..2628681 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  MHI44_RS13735 (MHI44_13735) yclK 2628668..2630089 (+) 1422 WP_339175803.1 two-component system sensor histidine kinase YclK -
  MHI44_RS13740 (MHI44_13740) rapC 2630253..2631401 (+) 1149 WP_003246686.1 response regulator aspartate phosphatase RapC Regulator
  MHI44_RS13745 (MHI44_13745) phrC 2631385..2631507 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  MHI44_RS13750 (MHI44_13750) - 2631607..2631696 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  MHI44_RS13755 (MHI44_13755) - 2631778..2631891 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  MHI44_RS13760 (MHI44_13760) - 2632045..2633409 (-) 1365 WP_003234493.1 aspartate kinase -
  MHI44_RS13765 (MHI44_13765) ceuB 2633794..2634744 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  MHI44_RS13770 (MHI44_13770) yclO 2634737..2635684 (+) 948 WP_213385825.1 iron chelate uptake ABC transporter family permease subunit -
  MHI44_RS13775 (MHI44_13775) yclP 2635678..2636436 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=968833 MHI44_RS13745 WP_003224994.1 2631385..2631507(+) (phrC) [Bacillus sp. FSL K6-1366]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=968833 MHI44_RS13745 WP_003224994.1 2631385..2631507(+) (phrC) [Bacillus sp. FSL K6-1366]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment