Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   MKX38_RS02155 Genome accession   NZ_CP150258
Coordinates   425882..426004 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus sp. FSL M8-0025     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 420882..431004
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  MKX38_RS02140 (MKX38_02140) yclJ 422496..423179 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  MKX38_RS02145 (MKX38_02145) yclK 423166..424587 (+) 1422 WP_163190361.1 two-component system sensor histidine kinase YclK -
  MKX38_RS02150 (MKX38_02150) rapC 424750..425898 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  MKX38_RS02155 (MKX38_02155) phrC 425882..426004 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  MKX38_RS02160 (MKX38_02160) - 426102..426191 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  MKX38_RS02165 (MKX38_02165) - 426273..426386 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  MKX38_RS02170 (MKX38_02170) - 426539..427903 (-) 1365 WP_041340152.1 aspartate kinase -
  MKX38_RS02175 (MKX38_02175) ceuB 428288..429238 (+) 951 WP_262120201.1 petrobactin ABC transporter permease YclN Machinery gene
  MKX38_RS02180 (MKX38_02180) yclO 429231..430178 (+) 948 WP_338382220.1 petrobactin ABC transporter permease YclO -
  MKX38_RS02185 (MKX38_02185) yclP 430172..430930 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=968278 MKX38_RS02155 WP_003224994.1 425882..426004(+) (phrC) [Bacillus sp. FSL M8-0025]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=968278 MKX38_RS02155 WP_003224994.1 425882..426004(+) (phrC) [Bacillus sp. FSL M8-0025]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment