Detailed information    

insolico Bioinformatically predicted

Overview

Name   sinI   Type   Regulator
Locus tag   NST56_RS13655 Genome accession   NZ_CP150195
Coordinates   2580903..2581076 (+) Length   57 a.a.
NCBI ID   WP_010334916.1    Uniprot ID   -
Organism   Bacillus sp. FSL R5-0560     
Function   inhibit the expression of sinR (predicted from homology)   
Competence regulation

Genomic Context

Location: 2575903..2586076
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  NST56_RS13640 (NST56_13640) gcvT 2576703..2577791 (-) 1089 WP_339177138.1 glycine cleavage system aminomethyltransferase GcvT -
  NST56_RS13645 (NST56_13645) - 2578235..2579908 (+) 1674 WP_168748225.1 SNF2-related protein -
  NST56_RS13650 (NST56_13650) - 2579929..2580723 (+) 795 WP_339177142.1 YqhG family protein -
  NST56_RS13655 (NST56_13655) sinI 2580903..2581076 (+) 174 WP_010334916.1 anti-repressor SinI family protein Regulator
  NST56_RS13660 (NST56_13660) sinR 2581110..2581445 (+) 336 WP_003226345.1 transcriptional regulator SinR Regulator
  NST56_RS13665 (NST56_13665) tasA 2581533..2582318 (-) 786 WP_168748227.1 biofilm matrix protein TasA -
  NST56_RS13670 (NST56_13670) - 2582383..2582967 (-) 585 WP_339177148.1 signal peptidase I -
  NST56_RS13675 (NST56_13675) tapA 2582939..2583700 (-) 762 WP_339177150.1 amyloid fiber anchoring/assembly protein TapA -
  NST56_RS13680 (NST56_13680) - 2583977..2584300 (+) 324 WP_168748230.1 YqzG/YhdC family protein -
  NST56_RS13685 (NST56_13685) - 2584343..2584522 (-) 180 WP_003236949.1 YqzE family protein -
  NST56_RS13690 (NST56_13690) comGG 2584594..2584968 (-) 375 WP_339177153.1 competence type IV pilus minor pilin ComGG Machinery gene
  NST56_RS13695 (NST56_13695) comGF 2584969..2585352 (-) 384 WP_339177156.1 competence type IV pilus minor pilin ComGF Machinery gene
  NST56_RS13700 (NST56_13700) comGE 2585378..2585725 (-) 348 WP_168748233.1 competence type IV pilus minor pilin ComGE Machinery gene

Sequence

Protein


Download         Length: 57 a.a.        Molecular weight: 6687.63 Da        Isoelectric Point: 6.4604

>NTDB_id=965848 NST56_RS13655 WP_010334916.1 2580903..2581076(+) (sinI) [Bacillus sp. FSL R5-0560]
MKNAKQEHFELDQEWVELMMEAREANISPEEIRKYLLLNKKSAYPGPAARSHTVNPF

Nucleotide


Download         Length: 174 bp        

>NTDB_id=965848 NST56_RS13655 WP_010334916.1 2580903..2581076(+) (sinI) [Bacillus sp. FSL R5-0560]
ATGAAAAATGCAAAACAAGAGCACTTCGAATTGGATCAAGAATGGGTTGAATTAATGATGGAAGCCAGAGAAGCAAATAT
CAGCCCTGAGGAAATACGCAAATATTTACTTTTAAACAAAAAGTCTGCTTATCCTGGTCCGGCAGCCAGAAGTCATACCG
TAAATCCTTTCTGA

Domains

Predicted by InterproScan.

Anti-repressor SinI (SinI)

(11-36)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  sinI Bacillus subtilis subsp. subtilis str. 168

94.737

100

0.947

Multiple sequence alignment