Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   NST56_RS02185 Genome accession   NZ_CP150195
Coordinates   429341..429463 (+) Length   40 a.a.
NCBI ID   WP_010333023.1    Uniprot ID   Q6B9X2
Organism   Bacillus sp. FSL R5-0560     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 424341..434463
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  NST56_RS02170 (NST56_02170) yclJ 425946..426629 (+) 684 WP_010333020.1 two-component system response regulator YclJ -
  NST56_RS02175 (NST56_02175) - 426616..428031 (+) 1416 WP_268444288.1 HAMP domain-containing sensor histidine kinase -
  NST56_RS02180 (NST56_02180) rapC 428209..429357 (+) 1149 WP_268444289.1 response regulator aspartate phosphatase RapC Regulator
  NST56_RS02185 (NST56_02185) phrC 429341..429463 (+) 123 WP_010333023.1 PhrC/PhrF family phosphatase-inhibitory pheromone Regulator
  NST56_RS02190 (NST56_02190) - 429568..429660 (-) 93 WP_026014660.1 YjcZ family sporulation protein -
  NST56_RS02195 (NST56_02195) - 429808..429927 (-) 120 WP_268504129.1 YjcZ family sporulation protein -
  NST56_RS02200 (NST56_02200) - 430044..431408 (-) 1365 WP_268444290.1 aspartate kinase -
  NST56_RS02205 (NST56_02205) ceuB 431794..432744 (+) 951 WP_010333025.1 petrobactin ABC transporter permease YclN Machinery gene
  NST56_RS02210 (NST56_02210) yclO 432737..433684 (+) 948 WP_010333026.1 petrobactin ABC transporter permease YclO -
  NST56_RS02215 (NST56_02215) yclP 433678..434436 (+) 759 WP_268444292.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4208.97 Da        Isoelectric Point: 8.0579

>NTDB_id=965817 NST56_RS02185 WP_010333023.1 429341..429463(+) (phrC) [Bacillus sp. FSL R5-0560]
MKLKSKLFVICLAAAAVFTAVGVSAHAEASDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=965817 NST56_RS02185 WP_010333023.1 429341..429463(+) (phrC) [Bacillus sp. FSL R5-0560]
ATGAAATTGAAATCTAAGTTATTTGTTATTTGTTTGGCTGCAGCAGCTGTTTTTACAGCGGTTGGCGTCTCTGCACATGC
TGAAGCATCCGACTTCCATGTCACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB Q6B9X2

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

90

100

0.9

Multiple sequence alignment