Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   NSQ42_RS02155 Genome accession   NZ_CP150184
Coordinates   429291..429413 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus sp. FSL W8-0812     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 424291..434413
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  NSQ42_RS02140 (NSQ42_02140) yclJ 425905..426588 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  NSQ42_RS02145 (NSQ42_02145) yclK 426575..427996 (+) 1422 WP_009969263.1 two-component system sensor histidine kinase YclK -
  NSQ42_RS02150 (NSQ42_02150) rapC 428159..429307 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  NSQ42_RS02155 (NSQ42_02155) phrC 429291..429413 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  NSQ42_RS02160 (NSQ42_02160) - 429513..429602 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  NSQ42_RS02165 (NSQ42_02165) - 429684..429797 (-) 114 WP_032678937.1 YjcZ family sporulation protein -
  NSQ42_RS02170 (NSQ42_02170) - 429950..431314 (-) 1365 WP_029726569.1 aspartate kinase -
  NSQ42_RS02175 (NSQ42_02175) ceuB 431699..432649 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  NSQ42_RS02180 (NSQ42_02180) yclO 432642..433589 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  NSQ42_RS02185 (NSQ42_02185) yclP 433583..434341 (+) 759 WP_195727644.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=965332 NSQ42_RS02155 WP_003224994.1 429291..429413(+) (phrC) [Bacillus sp. FSL W8-0812]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=965332 NSQ42_RS02155 WP_003224994.1 429291..429413(+) (phrC) [Bacillus sp. FSL W8-0812]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1


Multiple sequence alignment