Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   NSU16_RS02220 Genome accession   NZ_CP150176
Coordinates   439608..439730 (+) Length   40 a.a.
NCBI ID   WP_010333023.1    Uniprot ID   Q6B9X2
Organism   Bacillus sp. FSL K6-1003     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 434608..444730
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  NSU16_RS02205 (NSU16_02205) yclJ 436213..436896 (+) 684 WP_010333020.1 two-component system response regulator YclJ -
  NSU16_RS02210 (NSU16_02210) - 436883..438298 (+) 1416 WP_268449656.1 HAMP domain-containing sensor histidine kinase -
  NSU16_RS02215 (NSU16_02215) rapC 438476..439624 (+) 1149 WP_168746930.1 response regulator aspartate phosphatase RapC Regulator
  NSU16_RS02220 (NSU16_02220) phrC 439608..439730 (+) 123 WP_010333023.1 PhrC/PhrF family phosphatase-inhibitory pheromone Regulator
  NSU16_RS02225 (NSU16_02225) - 439835..439927 (-) 93 WP_026014660.1 YjcZ family sporulation protein -
  NSU16_RS02230 (NSU16_02230) - 440085..440168 (-) 84 Protein_396 sporulation protein YjcZ -
  NSU16_RS02235 (NSU16_02235) - 440288..441652 (-) 1365 WP_168746931.1 aspartate kinase -
  NSU16_RS02240 (NSU16_02240) ceuB 442038..442988 (+) 951 WP_010333025.1 petrobactin ABC transporter permease YclN Machinery gene
  NSU16_RS02245 (NSU16_02245) yclO 442981..443928 (+) 948 WP_010333026.1 petrobactin ABC transporter permease YclO -
  NSU16_RS02250 (NSU16_02250) yclP 443922..444680 (+) 759 WP_268444292.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4208.97 Da        Isoelectric Point: 8.0579

>NTDB_id=964972 NSU16_RS02220 WP_010333023.1 439608..439730(+) (phrC) [Bacillus sp. FSL K6-1003]
MKLKSKLFVICLAAAAVFTAVGVSAHAEASDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=964972 NSU16_RS02220 WP_010333023.1 439608..439730(+) (phrC) [Bacillus sp. FSL K6-1003]
ATGAAATTGAAATCTAAGTTATTTGTTATTTGTTTGGCTGCAGCAGCTGTTTTTACAGCGGTTGGCGTCTCTGCACATGC
TGAAGCATCCGACTTCCATGTCACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB Q6B9X2

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

90

100

0.9

Multiple sequence alignment