Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   NST79_RS02215 Genome accession   NZ_CP150159
Coordinates   429478..429600 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus sp. PS196     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 424478..434600
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  NST79_RS02200 (NST79_02200) yclJ 426091..426774 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  NST79_RS02205 (NST79_02205) yclK 426761..428182 (+) 1422 WP_212059763.1 HAMP domain-containing sensor histidine kinase -
  NST79_RS02210 (NST79_02210) rapC 428346..429494 (+) 1149 WP_003246686.1 response regulator aspartate phosphatase RapC Regulator
  NST79_RS02215 (NST79_02215) phrC 429478..429600 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  NST79_RS02220 (NST79_02220) - 429700..429789 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  NST79_RS02225 (NST79_02225) - 429871..429984 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  NST79_RS02230 (NST79_02230) - 430138..431502 (-) 1365 WP_212059765.1 aspartate kinase -
  NST79_RS02235 (NST79_02235) ceuB 431887..432837 (+) 951 WP_087960839.1 petrobactin ABC transporter permease YclN Machinery gene
  NST79_RS02240 (NST79_02240) yclO 432830..433777 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  NST79_RS02245 (NST79_02245) yclP 433771..434529 (+) 759 WP_212059767.1 ABC transporter ATP-binding protein -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=963959 NST79_RS02215 WP_003224994.1 429478..429600(+) (phrC) [Bacillus sp. PS196]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=963959 NST79_RS02215 WP_003224994.1 429478..429600(+) (phrC) [Bacillus sp. PS196]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1