Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   WHO64_RS02165 Genome accession   NZ_CP148117
Coordinates   429559..429681 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis isolate FELIX_MS509     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 424559..434681
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  WHO64_RS02150 yclJ 426173..426856 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  WHO64_RS02155 yclK 426843..428264 (+) 1422 WP_009969263.1 two-component system sensor histidine kinase YclK -
  WHO64_RS02160 rapC 428427..429575 (+) 1149 WP_003246686.1 response regulator aspartate phosphatase RapC Regulator
  WHO64_RS02165 phrC 429559..429681 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  WHO64_RS02170 yczM 429781..429870 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  WHO64_RS02175 yczN 429952..430065 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  WHO64_RS02180 thrD 430219..431583 (-) 1365 WP_003234493.1 aspartate kinase -
  WHO64_RS02185 ceuB 431968..432918 (+) 951 WP_003234491.1 petrobactin ABC transporter permease YclN Machinery gene
  WHO64_RS02190 yclO 432911..433858 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  WHO64_RS02195 yclP 433852..434610 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=950999 WHO64_RS02165 WP_003224994.1 429559..429681(+) (phrC) [Bacillus subtilis isolate FELIX_MS509]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=950999 WHO64_RS02165 WP_003224994.1 429559..429681(+) (phrC) [Bacillus subtilis isolate FELIX_MS509]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1