Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   WHO32_RS02170 Genome accession   NZ_CP148112
Coordinates   429560..429682 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis isolate FELIX_MS504     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 424560..434682
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  WHO32_RS02155 yclJ 426174..426857 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  WHO32_RS02160 yclK 426844..428265 (+) 1422 WP_009969263.1 two-component system sensor histidine kinase YclK -
  WHO32_RS02165 rapC 428428..429576 (+) 1149 WP_003246686.1 response regulator aspartate phosphatase RapC Regulator
  WHO32_RS02170 phrC 429560..429682 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  WHO32_RS02175 yczM 429782..429871 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  WHO32_RS02180 yczN 429953..430066 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  WHO32_RS02185 thrD 430220..431584 (-) 1365 WP_003234493.1 aspartate kinase -
  WHO32_RS02190 ceuB 431969..432919 (+) 951 WP_003234491.1 petrobactin ABC transporter permease YclN Machinery gene
  WHO32_RS02195 yclO 432912..433859 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  WHO32_RS02200 yclP 433853..434611 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=950805 WHO32_RS02170 WP_003224994.1 429560..429682(+) (phrC) [Bacillus subtilis isolate FELIX_MS504]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=950805 WHO32_RS02170 WP_003224994.1 429560..429682(+) (phrC) [Bacillus subtilis isolate FELIX_MS504]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1