Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   WHL98_RS02180 Genome accession   NZ_CP148104
Coordinates   430823..430945 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis subsp. subtilis isolate FELIX_MS438     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 425823..435945
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  WHL98_RS02165 yclJ 427437..428120 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  WHL98_RS02170 yclK 428107..429528 (+) 1422 WP_009969263.1 two-component system sensor histidine kinase YclK -
  WHL98_RS02175 rapC 429691..430839 (+) 1149 WP_003246686.1 response regulator aspartate phosphatase RapC Regulator
  WHL98_RS02180 phrC 430823..430945 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  WHL98_RS02185 yczM 431045..431134 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  WHL98_RS02190 yczN 431216..431329 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  WHL98_RS02195 thrD 431483..432847 (-) 1365 WP_009966541.1 aspartate kinase -
  WHL98_RS02200 ceuB 433232..434182 (+) 951 WP_003234491.1 petrobactin ABC transporter permease YclN Machinery gene
  WHL98_RS02205 yclO 434175..435122 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  WHL98_RS02210 yclP 435116..435874 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=950566 WHL98_RS02180 WP_003224994.1 430823..430945(+) (phrC) [Bacillus subtilis subsp. subtilis isolate FELIX_MS438]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=950566 WHL98_RS02180 WP_003224994.1 430823..430945(+) (phrC) [Bacillus subtilis subsp. subtilis isolate FELIX_MS438]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1