Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   WHL49_RS02175 Genome accession   NZ_CP148103
Coordinates   430362..430484 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis subsp. subtilis isolate FELIX_MS361     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 425362..435484
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  WHL49_RS02160 yclJ 426976..427659 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  WHL49_RS02165 yclK 427646..429067 (+) 1422 WP_009969263.1 two-component system sensor histidine kinase YclK -
  WHL49_RS02170 rapC 429230..430378 (+) 1149 WP_003246686.1 response regulator aspartate phosphatase RapC Regulator
  WHL49_RS02175 phrC 430362..430484 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  WHL49_RS02180 yczM 430584..430673 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  WHL49_RS02185 yczN 430755..430868 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  WHL49_RS02190 thrD 431022..432386 (-) 1365 WP_009966541.1 aspartate kinase -
  WHL49_RS02195 ceuB 432771..433721 (+) 951 WP_003234491.1 petrobactin ABC transporter permease YclN Machinery gene
  WHL49_RS02200 yclO 433714..434661 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  WHL49_RS02205 yclP 434655..435413 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=950480 WHL49_RS02175 WP_003224994.1 430362..430484(+) (phrC) [Bacillus subtilis subsp. subtilis isolate FELIX_MS361]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=950480 WHL49_RS02175 WP_003224994.1 430362..430484(+) (phrC) [Bacillus subtilis subsp. subtilis isolate FELIX_MS361]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1