Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   WBI56_RS02165 Genome accession   NZ_CP147492
Coordinates   428479..428601 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain MC4-2     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 423479..433601
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  WBI56_RS02150 (WBI56_02150) yclJ 425092..425775 (+) 684 WP_015482792.1 two-component system response regulator YclJ -
  WBI56_RS02155 (WBI56_02155) yclK 425762..427183 (+) 1422 WP_072173981.1 two-component system sensor histidine kinase YclK -
  WBI56_RS02160 (WBI56_02160) rapC 427347..428495 (+) 1149 WP_338732280.1 response regulator aspartate phosphatase RapC Regulator
  WBI56_RS02165 (WBI56_02165) phrC 428479..428601 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  WBI56_RS02170 (WBI56_02170) yczM 428699..428788 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  WBI56_RS02175 (WBI56_02175) yczN 428870..428983 (-) 114 WP_014478831.1 YjcZ family sporulation protein -
  WBI56_RS02180 (WBI56_02180) thrD 429136..430500 (-) 1365 WP_338732285.1 aspartate kinase -
  WBI56_RS02185 (WBI56_02185) ceuB 430885..431835 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  WBI56_RS02190 (WBI56_02190) yclO 431828..432775 (+) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  WBI56_RS02195 (WBI56_02195) yclP 432769..433527 (+) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=946313 WBI56_RS02165 WP_003224994.1 428479..428601(+) (phrC) [Bacillus subtilis strain MC4-2]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=946313 WBI56_RS02165 WP_003224994.1 428479..428601(+) (phrC) [Bacillus subtilis strain MC4-2]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1