Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   V5F86_RS02155 Genome accession   NZ_CP145137
Coordinates   426327..426449 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus spizizenii strain kcgeb_sc     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 421327..431449
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  V5F86_RS02140 (V5F86_02145) yclJ 422942..423625 (+) 684 WP_338443753.1 two-component system response regulator YclJ -
  V5F86_RS02145 (V5F86_02150) yclK 423612..425033 (+) 1422 WP_338443755.1 two-component system sensor histidine kinase YclK -
  V5F86_RS02150 (V5F86_02155) rapC 425195..426343 (+) 1149 WP_338443756.1 response regulator aspartate phosphatase RapC Regulator
  V5F86_RS02155 (V5F86_02160) phrC 426327..426449 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  V5F86_RS02160 (V5F86_02165) - 426549..426656 (-) 108 WP_338443757.1 YjcZ family sporulation protein -
  V5F86_RS02165 (V5F86_02170) - 426809..428173 (-) 1365 WP_088680298.1 aspartate kinase -
  V5F86_RS02170 (V5F86_02175) ceuB 428558..429508 (+) 951 WP_061186190.1 petrobactin ABC transporter permease YclN Machinery gene
  V5F86_RS02175 (V5F86_02180) yclO 429501..430448 (+) 948 WP_268392909.1 petrobactin ABC transporter permease YclO -
  V5F86_RS02180 (V5F86_02185) yclP 430442..431200 (+) 759 WP_014112653.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=937387 V5F86_RS02155 WP_003224994.1 426327..426449(+) (phrC) [Bacillus spizizenii strain kcgeb_sc]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=937387 V5F86_RS02155 WP_003224994.1 426327..426449(+) (phrC) [Bacillus spizizenii strain kcgeb_sc]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCTGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACGGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1