Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   VDS58_RS02190 Genome accession   NZ_CP141997
Coordinates   434553..434675 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain PM0031     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 429553..439675
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  VDS58_RS02175 (VDS58_02175) yclJ 431167..431850 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  VDS58_RS02180 (VDS58_02180) yclK 431837..433258 (+) 1422 WP_072173981.1 two-component system sensor histidine kinase YclK -
  VDS58_RS02185 (VDS58_02185) rapC 433421..434569 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  VDS58_RS02190 (VDS58_02190) phrC 434553..434675 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  VDS58_RS02195 (VDS58_02195) yczM 434774..434863 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  VDS58_RS02200 (VDS58_02200) yczN 434945..435058 (-) 114 WP_014478831.1 YjcZ family sporulation protein -
  VDS58_RS02205 (VDS58_02205) thrD 435211..436575 (-) 1365 WP_021481755.1 aspartate kinase -
  VDS58_RS02210 (VDS58_02210) ceuB 436966..437916 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  VDS58_RS02215 (VDS58_02215) yclO 437909..438856 (+) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  VDS58_RS02220 (VDS58_02220) yclP 438850..439608 (+) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=920695 VDS58_RS02190 WP_003224994.1 434553..434675(+) (phrC) [Bacillus subtilis strain PM0031]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=920695 VDS58_RS02190 WP_003224994.1 434553..434675(+) (phrC) [Bacillus subtilis strain PM0031]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1