Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   U7118_RS20335 Genome accession   NZ_CP141283
Coordinates   3760688..3760810 (-) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain DKU_09     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 3755688..3765810
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  U7118_RS20305 (U7118_20305) yclP 3755759..3756517 (-) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -
  U7118_RS20310 (U7118_20310) yclO 3756511..3757458 (-) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  U7118_RS20315 (U7118_20315) ceuB 3757451..3758401 (-) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  U7118_RS20320 (U7118_20320) thrD 3758786..3760150 (+) 1365 WP_033883679.1 aspartate kinase -
  U7118_RS20325 (U7118_20325) yczN 3760304..3760417 (+) 114 WP_003234495.1 YjcZ family sporulation protein -
  U7118_RS20330 (U7118_20330) yczM 3760499..3760588 (+) 90 WP_015482794.1 YjcZ family sporulation protein -
  U7118_RS20335 (U7118_20335) phrC 3760688..3760810 (-) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  U7118_RS20340 (U7118_20340) rapC 3760794..3761942 (-) 1149 WP_017696151.1 response regulator aspartate phosphatase RapC Regulator
  U7118_RS20345 (U7118_20345) yclK 3762106..3763527 (-) 1422 WP_324271385.1 two-component system sensor histidine kinase YclK -
  U7118_RS20350 (U7118_20350) yclJ 3763514..3764197 (-) 684 WP_003246532.1 two-component system response regulator YclJ -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=916854 U7118_RS20335 WP_003224994.1 3760688..3760810(-) (phrC) [Bacillus subtilis strain DKU_09]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=916854 U7118_RS20335 WP_003224994.1 3760688..3760810(-) (phrC) [Bacillus subtilis strain DKU_09]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1