Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   SIS06_RS02150 Genome accession   NZ_CP139188
Coordinates   425830..425952 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain H17-16     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 420830..430952
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  SIS06_RS02135 (SIS06_02135) yclJ 422444..423127 (+) 684 WP_283934053.1 two-component system response regulator YclJ -
  SIS06_RS02140 (SIS06_02140) yclK 423114..424535 (+) 1422 WP_072173981.1 two-component system sensor histidine kinase YclK -
  SIS06_RS02145 (SIS06_02145) rapC 424698..425846 (+) 1149 WP_283934054.1 response regulator aspartate phosphatase RapC Regulator
  SIS06_RS02150 (SIS06_02150) phrC 425830..425952 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  SIS06_RS02155 (SIS06_02155) yczM 426052..426141 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  SIS06_RS02160 (SIS06_02160) yczN 426223..426336 (-) 114 WP_032728921.1 YjcZ family sporulation protein -
  SIS06_RS02165 (SIS06_02165) thrD 426489..427853 (-) 1365 WP_015715246.1 aspartate kinase -
  SIS06_RS02170 (SIS06_02170) ceuB 428238..429188 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  SIS06_RS02175 (SIS06_02175) yclO 429181..430128 (+) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  SIS06_RS02180 (SIS06_02180) yclP 430122..430880 (+) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=907602 SIS06_RS02150 WP_003224994.1 425830..425952(+) (phrC) [Bacillus subtilis strain H17-16]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=907602 SIS06_RS02150 WP_003224994.1 425830..425952(+) (phrC) [Bacillus subtilis strain H17-16]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1