Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   R6I06_RS02045 Genome accession   NZ_CP137711
Coordinates   401461..401583 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis isolate FELIX_MS886     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 396461..406583
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  R6I06_RS02030 (R6I06_02030) yclJ 398075..398758 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  R6I06_RS02035 (R6I06_02035) yclK 398745..400166 (+) 1422 WP_009969263.1 two-component system sensor histidine kinase YclK -
  R6I06_RS02040 (R6I06_02040) rapC 400329..401477 (+) 1149 WP_003246686.1 response regulator aspartate phosphatase RapC Regulator
  R6I06_RS02045 (R6I06_02045) phrC 401461..401583 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  R6I06_RS02050 (R6I06_02050) yczM 401683..401772 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  R6I06_RS02055 (R6I06_02055) yczN 401854..401967 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  R6I06_RS02060 (R6I06_02060) thrD 402121..403485 (-) 1365 WP_009966541.1 aspartate kinase -
  R6I06_RS02065 (R6I06_02065) ceuB 403870..404820 (+) 951 WP_003234491.1 petrobactin ABC transporter permease YclN Machinery gene
  R6I06_RS02070 (R6I06_02070) yclO 404813..405760 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  R6I06_RS02075 (R6I06_02075) yclP 405754..406512 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=900087 R6I06_RS02045 WP_003224994.1 401461..401583(+) (phrC) [Bacillus subtilis isolate FELIX_MS886]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=900087 R6I06_RS02045 WP_003224994.1 401461..401583(+) (phrC) [Bacillus subtilis isolate FELIX_MS886]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1