Detailed information    

insolico Bioinformatically predicted

Overview

Name   sinI   Type   Regulator
Locus tag   RYX39_RS12695 Genome accession   NZ_CP136430
Coordinates   2484991..2485164 (+) Length   57 a.a.
NCBI ID   WP_024122036.1    Uniprot ID   -
Organism   Bacillus halotolerans strain Q2H2     
Function   inhibit the expression of sinR (predicted from homology)   
Competence regulation

Genomic Context

Location: 2479991..2490164
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  RYX39_RS12680 (RYX39_12680) gcvT 2480788..2481876 (-) 1089 WP_188323131.1 glycine cleavage system aminomethyltransferase GcvT -
  RYX39_RS12685 (RYX39_12685) - 2482320..2483993 (+) 1674 WP_127696774.1 DEAD/DEAH box helicase -
  RYX39_RS12690 (RYX39_12690) - 2484013..2484807 (+) 795 WP_127696773.1 YqhG family protein -
  RYX39_RS12695 (RYX39_12695) sinI 2484991..2485164 (+) 174 WP_024122036.1 anti-repressor SinI Regulator
  RYX39_RS12700 (RYX39_12700) sinR 2485198..2485533 (+) 336 WP_003226345.1 transcriptional regulator SinR Regulator
  RYX39_RS12705 (RYX39_12705) tasA 2485620..2486405 (-) 786 WP_316961079.1 biofilm matrix protein TasA -
  RYX39_RS12710 (RYX39_12710) sipW 2486470..2487054 (-) 585 WP_105955579.1 signal peptidase I SipW -
  RYX39_RS12715 (RYX39_12715) tapA 2487026..2487787 (-) 762 WP_106020093.1 amyloid fiber anchoring/assembly protein TapA -
  RYX39_RS12720 (RYX39_12720) - 2488055..2488378 (+) 324 WP_101864527.1 YqzG/YhdC family protein -
  RYX39_RS12725 (RYX39_12725) - 2488421..2488600 (-) 180 WP_003236949.1 YqzE family protein -
  RYX39_RS12730 (RYX39_12730) comGG 2488672..2489046 (-) 375 WP_188323133.1 competence type IV pilus minor pilin ComGG Machinery gene
  RYX39_RS12735 (RYX39_12735) comGF 2489047..2489466 (-) 420 WP_316961080.1 competence type IV pilus minor pilin ComGF Machinery gene
  RYX39_RS12740 (RYX39_12740) comGE 2489456..2489803 (-) 348 WP_151175142.1 competence type IV pilus minor pilin ComGE Machinery gene

Sequence

Protein


Download         Length: 57 a.a.        Molecular weight: 6675.62 Da        Isoelectric Point: 6.7231

>NTDB_id=891033 RYX39_RS12695 WP_024122036.1 2484991..2485164(+) (sinI) [Bacillus halotolerans strain Q2H2]
MKNAKQEHFELDQEWVELMMEAREANISPEEIRKYLLLNKKSAHPGPAARSHTINPF

Nucleotide


Download         Length: 174 bp        

>NTDB_id=891033 RYX39_RS12695 WP_024122036.1 2484991..2485164(+) (sinI) [Bacillus halotolerans strain Q2H2]
ATGAAAAATGCAAAACAAGAGCACTTCGAATTAGATCAAGAATGGGTTGAATTAATGATGGAAGCCAGAGAAGCAAATAT
CAGCCCTGAGGAAATACGCAAATATTTACTTTTAAACAAAAAGTCTGCTCATCCTGGTCCGGCAGCCAGAAGTCATACCA
TAAATCCTTTCTGA

Domains

Predicted by InterproScan.

Anti-repressor SinI (SinI)

(11-36)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  sinI Bacillus subtilis subsp. subtilis str. 168

94.737

100

0.947