Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   RW107_RS02155 Genome accession   NZ_CP136257
Coordinates   432646..432768 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain A9     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 427646..437768
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  RW107_RS02140 (RW107_02140) yclJ 429259..429942 (+) 684 WP_015482792.1 two-component system response regulator YclJ -
  RW107_RS02145 (RW107_02145) yclK 429929..431350 (+) 1422 WP_072173981.1 two-component system sensor histidine kinase YclK -
  RW107_RS02150 (RW107_02150) rapC 431514..432662 (+) 1149 WP_038828432.1 response regulator aspartate phosphatase RapC Regulator
  RW107_RS02155 (RW107_02155) phrC 432646..432768 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  RW107_RS02160 (RW107_02160) yczM 432868..432957 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  RW107_RS02165 (RW107_02165) yczN 433039..433152 (-) 114 WP_014478831.1 YjcZ family sporulation protein -
  RW107_RS02170 (RW107_02170) thrD 433305..434669 (-) 1365 WP_072173982.1 aspartate kinase -
  RW107_RS02175 (RW107_02175) ceuB 435054..436004 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  RW107_RS02180 (RW107_02180) yclO 435997..436944 (+) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  RW107_RS02185 (RW107_02185) yclP 436938..437696 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=889856 RW107_RS02155 WP_003224994.1 432646..432768(+) (phrC) [Bacillus subtilis strain A9]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=889856 RW107_RS02155 WP_003224994.1 432646..432768(+) (phrC) [Bacillus subtilis strain A9]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1