Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   RFN60_RS02170 Genome accession   NZ_CP133653
Coordinates   428494..428616 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain CP38     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 423494..433616
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  RFN60_RS02155 (RFN60_02155) yclJ 425108..425791 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  RFN60_RS02160 (RFN60_02160) yclK 425778..427199 (+) 1422 WP_080348068.1 two-component system sensor histidine kinase YclK -
  RFN60_RS02165 (RFN60_02165) rapC 427362..428510 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  RFN60_RS02170 (RFN60_02170) phrC 428494..428616 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  RFN60_RS02175 (RFN60_02175) yczM 428716..428805 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  RFN60_RS02180 (RFN60_02180) yczN 428887..429000 (-) 114 WP_032678937.1 YjcZ family sporulation protein -
  RFN60_RS02185 (RFN60_02185) thrD 429153..430517 (-) 1365 WP_015715246.1 aspartate kinase -
  RFN60_RS02190 (RFN60_02190) ceuB 430902..431852 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  RFN60_RS02195 (RFN60_02195) yclO 431845..432792 (+) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  RFN60_RS02200 (RFN60_02200) yclP 432786..433544 (+) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=875543 RFN60_RS02170 WP_003224994.1 428494..428616(+) (phrC) [Bacillus subtilis strain CP38]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=875543 RFN60_RS02170 WP_003224994.1 428494..428616(+) (phrC) [Bacillus subtilis strain CP38]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1