Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   WDR05_RS02150 Genome accession   NZ_CP149444
Coordinates   428094..428216 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain HC-9     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 423094..433216
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  WDR05_RS02135 (WDR05_02145) yclJ 424708..425391 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  WDR05_RS02140 (WDR05_02150) yclK 425378..426799 (+) 1422 WP_113713032.1 two-component system sensor histidine kinase YclK -
  WDR05_RS02145 (WDR05_02155) rapC 426962..428110 (+) 1149 WP_003246686.1 response regulator aspartate phosphatase RapC Regulator
  WDR05_RS02150 (WDR05_02160) phrC 428094..428216 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  WDR05_RS02155 (WDR05_02165) yczM 428316..428405 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  WDR05_RS02160 (WDR05_02170) yczN 428487..428600 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  WDR05_RS02165 (WDR05_02175) thrD 428754..430118 (-) 1365 WP_113713033.1 aspartate kinase -
  WDR05_RS02170 (WDR05_02180) ceuB 430503..431453 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  WDR05_RS02175 (WDR05_02185) yclO 431446..432393 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  WDR05_RS02180 (WDR05_02190) yclP 432387..433145 (+) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=873829 WDR05_RS02150 WP_003224994.1 428094..428216(+) (phrC) [Bacillus subtilis strain HC-9]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=873829 WDR05_RS02150 WP_003224994.1 428094..428216(+) (phrC) [Bacillus subtilis strain HC-9]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1