Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   K6J86_RS02120 Genome accession   NZ_AP024627
Coordinates   423670..423792 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain BEST3136     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 418670..428792
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  K6J86_RS02105 (BsBEST3136_03780) yclJ 420284..420967 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  K6J86_RS02110 (BsBEST3136_03790) yclK 420954..422375 (+) 1422 WP_009969263.1 two-component system sensor histidine kinase YclK -
  K6J86_RS02115 (BsBEST3136_03800) rapC 422538..423686 (+) 1149 WP_003246686.1 response regulator aspartate phosphatase RapC Regulator
  K6J86_RS02120 (BsBEST3136_03810) phrC 423670..423792 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  K6J86_RS02125 yczM 423892..423981 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  K6J86_RS02130 yczN 424063..424176 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  K6J86_RS02135 (BsBEST3136_03820) thrD 424330..425694 (-) 1365 WP_009966541.1 aspartate kinase -
  K6J86_RS02140 (BsBEST3136_03830) ceuB 426079..427029 (+) 951 WP_003234491.1 petrobactin ABC transporter permease YclN Machinery gene
  K6J86_RS02145 (BsBEST3136_03840) yclO 427022..427969 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  K6J86_RS02150 (BsBEST3136_03850) yclP 427963..428721 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=87255 K6J86_RS02120 WP_003224994.1 423670..423792(+) (phrC) [Bacillus subtilis strain BEST3136]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=87255 K6J86_RS02120 WP_003224994.1 423670..423792(+) (phrC) [Bacillus subtilis strain BEST3136]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment