NTDB

Overview

Name	comGE/cglE	Type	Machinery gene
Locus tag	Q7623_RS10075	Genome accession	NZ_CP131710
Coordinates	1932746..1933048 (-)	Length	100 a.a.
NCBI ID	WP_000413382.1	Uniprot ID	-
Organism	Streptococcus pneumoniae strain 2014S11-203
Function	dsDNA binding to the cell surface; assembly of the pseudopilus (predicted from homology) DNA binding and uptake

Genomic Context

Location: 1927746..1938048

Locus tag	Gene name	Coordinates (strand)	Size (bp)	Protein ID	Product	Description
Q7623_RS10040 (Q7623_10005)	rnpA	1928428..1928799 (-)	372	WP_000739246.1	ribonuclease P protein component	-
Q7623_RS10045 (Q7623_10010)	-	1928816..1928947 (-)	132	WP_000768904.1	hypothetical protein	-
Q7623_RS10050 (Q7623_10015)	-	1928948..1930138 (-)	1191	WP_000167765.1	acetate kinase	-
Q7623_RS10055 (Q7623_10020)	comYH	1930189..1931142 (-)	954	WP_000345126.1	class I SAM-dependent methyltransferase	Machinery gene
Q7623_RS10060 (Q7623_10025)	-	1931203..1931795 (-)	593	Protein_1957	methyltransferase domain-containing protein	-
Q7623_RS10065 (Q7623_10030)	comGG/cglG	1931898..1932344 (-)	447	WP_001809944.1	competence type IV pilus minor pilin ComGG	Machinery gene
Q7623_RS10070 (Q7623_10035)	comGF/cglF	1932322..1932783 (-)	462	WP_000250531.1	competence type IV pilus minor pilin ComGF	Machinery gene
Q7623_RS10075 (Q7623_10040)	comGE/cglE	1932746..1933048 (-)	303	WP_000413382.1	competence type IV pilus minor pilin ComGE	Machinery gene
Q7623_RS10080 (Q7623_10045)	comGD/cglD	1933011..1933445 (-)	435	WP_033606693.1	competence type IV pilus minor pilin ComGD	Machinery gene
Q7623_RS10085 (Q7623_10050)	comGC/cglC	1933408..1933731 (-)	324	WP_000738628.1	comG operon protein ComGC	Machinery gene
Q7623_RS10090 (Q7623_10055)	comGB/cglB	1933733..1934749 (-)	1017	WP_078130737.1	competence type IV pilus assembly protein ComGB	Machinery gene
Q7623_RS10095 (Q7623_10060)	comGA/cglA/cilD	1934697..1935638 (-)	942	WP_000249536.1	competence type IV pilus ATPase ComGA	Machinery gene
Q7623_RS10100 (Q7623_10065)	-	1935714..1936079 (-)	366	WP_000286415.1	DUF1033 family protein	-
Q7623_RS10105 (Q7623_10070)	-	1936230..1937288 (-)	1059	WP_000649468.1	zinc-dependent alcohol dehydrogenase family protein	-

Sequence

Protein

Download Length: 100 a.a. Molecular weight: 11108.08 Da Isoelectric Point: 9.7273

                                >NTDB_id=864147 Q7623_RS10075 WP_000413382.1 1932746..1933048(-) (comGE/cglE) [Streptococcus pneumoniae strain 2014S11-203]

MEKLNALRKQKIRAVILLEAVVALAIFASIATLLLGQIQKNRQEEAKILQKEEVLRVAKMALQTGQNQVSINGVEIQVFS

SEKGLEVYHGSEQLLAIKEP

Nucleotide

Download Length: 303 bp

                                >NTDB_id=864147 Q7623_RS10075 WP_000413382.1 1932746..1933048(-) (comGE/cglE) [Streptococcus pneumoniae strain 2014S11-203]

ATGGAAAAATTAAACGCATTAAGGAAACAAAAAATTAGGGCAGTGATTTTACTGGAAGCAGTAGTCGCTCTAGCTATCTT

TGCCAGCATTGCGACCCTCCTTTTGGGACAAATTCAAAAAAATAGGCAAGAGGAAGCAAAAATCTTGCAAAAGGAAGAAG

TCTTGAGGGTAGCTAAGATGGCCTTGCAGACGGGGCAAAATCAGGTAAGCATCAACGGAGTTGAGATTCAGGTATTTTCT

AGTGAAAAAGGATTGGAGGTCTACCATGGTTCAGAACAGTTGTTGGCAATCAAAGAGCCATAA

Domains

Predicted by InterproScan.

Type II secretory pathway pseudopilin (ComGE)

(16-97)

Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.

3D structure

Source	ID	Structure

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.

Visualization of predicted probability:

Similar proteins

Only experimentally validated proteins are listed.

Protein	Organism	Identities (%)	Coverage (%)	H_a-value
comGE/cglE	Streptococcus pneumoniae Rx1	100	100	1
comGE/cglE	Streptococcus pneumoniae D39	100	100	1
comGE/cglE	Streptococcus pneumoniae R6	100	100	1
comGE/cglE	Streptococcus pneumoniae TIGR4	100	100	1
comGE/cglE	Streptococcus mitis NCTC 12261	98	100	0.98
comGE/cglE	Streptococcus mitis SK321	98	100	0.98
comYE	Streptococcus mutans UA140	44.444	90	0.4
comYE	Streptococcus mutans UA159	44.444	90	0.4

Detailed information NTG0864147