Detailed information    

insolico Bioinformatically predicted

Overview


Name   sinI   Type   Regulator
Locus tag   QRD86_RS13145 Genome accession   NZ_CP128116
Coordinates   2481991..2482164 (+) Length   57 a.a.
NCBI ID   WP_024122036.1    Uniprot ID   -
Organism   Bacillus halotolerans strain KF17     
Function   inhibit the expression of sinR (predicted from homology)   
Competence regulation

Genomic Context


Location: 2476991..2487164
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  QRD86_RS13130 (QRD86_13125) gcvT 2477789..2478877 (-) 1089 WP_151175141.1 glycine cleavage system aminomethyltransferase GcvT -
  QRD86_RS13135 (QRD86_13130) - 2479320..2480993 (+) 1674 WP_127696774.1 SNF2-related protein -
  QRD86_RS13140 (QRD86_13135) - 2481013..2481807 (+) 795 WP_127696773.1 YqhG family protein -
  QRD86_RS13145 (QRD86_13140) sinI 2481991..2482164 (+) 174 WP_024122036.1 anti-repressor SinI Regulator
  QRD86_RS13150 (QRD86_13145) sinR 2482198..2482533 (+) 336 WP_003226345.1 transcriptional regulator SinR Regulator
  QRD86_RS13155 (QRD86_13150) tasA 2482620..2483405 (-) 786 WP_106020091.1 biofilm matrix protein TasA -
  QRD86_RS13160 (QRD86_13155) - 2483470..2484054 (-) 585 WP_105955579.1 signal peptidase I SipW -
  QRD86_RS13165 (QRD86_13160) tapA 2484026..2484787 (-) 762 WP_106020093.1 amyloid fiber anchoring/assembly protein TapA -
  QRD86_RS13170 (QRD86_13165) - 2485065..2485388 (+) 324 WP_024122040.1 YqzG/YhdC family protein -
  QRD86_RS13175 (QRD86_13170) - 2485431..2485610 (-) 180 WP_003236949.1 YqzE family protein -
  QRD86_RS13180 (QRD86_13175) comGG 2485682..2486056 (-) 375 WP_106020094.1 competence type IV pilus minor pilin ComGG Machinery gene
  QRD86_RS13185 (QRD86_13180) comGF 2486057..2486440 (-) 384 WP_038954226.1 competence type IV pilus minor pilin ComGF Machinery gene
  QRD86_RS13190 (QRD86_13185) comGE 2486466..2486813 (-) 348 WP_106020095.1 competence type IV pilus minor pilin ComGE Machinery gene

Sequence


Protein


Download         Length: 57 a.a.        Molecular weight: 6675.62 Da        Isoelectric Point: 6.7231

>NTDB_id=846035 QRD86_RS13145 WP_024122036.1 2481991..2482164(+) (sinI) [Bacillus halotolerans strain KF17]
MKNAKQEHFELDQEWVELMMEAREANISPEEIRKYLLLNKKSAHPGPAARSHTINPF

Nucleotide


Download         Length: 174 bp        

>NTDB_id=846035 QRD86_RS13145 WP_024122036.1 2481991..2482164(+) (sinI) [Bacillus halotolerans strain KF17]
ATGAAAAATGCAAAACAAGAGCACTTCGAATTAGATCAAGAATGGGTTGAATTAATGATGGAAGCCAGAGAAGCAAATAT
CAGCCCTGAGGAAATACGCAAATATTTACTTTTAAACAAAAAGTCTGCTCATCCTGGTCCGGCAGCCAGAAGTCATACCA
TAAATCCTTTCTGA

Domains


Predicted by InterProScan.

(11-36)


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  sinI Bacillus subtilis subsp. subtilis str. 168

94.737

100

0.947