Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   QLQ02_RS04885 Genome accession   NZ_CP127833
Coordinates   960020..960142 (-) Length   40 a.a.
NCBI ID   WP_024120213.1    Uniprot ID   A0A9Q6A750
Organism   Bacillus mojavensis strain KRS009     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 955020..965142
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  QLQ02_RS04855 yclP 955058..955816 (-) 759 WP_268444292.1 petrobactin ABC transporter ATP-binding protein YclP -
  QLQ02_RS04860 yclO 955810..956757 (-) 948 WP_010333026.1 petrobactin ABC transporter permease YclO -
  QLQ02_RS04865 ceuB 956750..957700 (-) 951 WP_010333025.1 petrobactin ABC transporter permease YclN Machinery gene
  QLQ02_RS04870 - 958086..959450 (+) 1365 WP_286059049.1 aspartate kinase -
  QLQ02_RS04875 - 959570..959653 (+) 84 Protein_941 sporulation protein YjcZ -
  QLQ02_RS04880 - 959823..959915 (+) 93 WP_026014660.1 YjcZ family sporulation protein -
  QLQ02_RS04885 phrC 960020..960142 (-) 123 WP_024120213.1 PhrC/PhrF family phosphatase-inhibitory pheromone Regulator
  QLQ02_RS04890 rapC 960126..961274 (-) 1149 WP_024120212.1 response regulator aspartate phosphatase RapC Regulator
  QLQ02_RS04895 - 961452..962867 (-) 1416 WP_286059050.1 HAMP domain-containing sensor histidine kinase -
  QLQ02_RS04900 yclJ 962854..963537 (-) 684 WP_010333020.1 two-component system response regulator YclJ -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4267.00 Da        Isoelectric Point: 7.1634

>NTDB_id=844424 QLQ02_RS04885 WP_024120213.1 960020..960142(-) (phrC) [Bacillus mojavensis strain KRS009]
MKLKSKLFVICLAAAAVFTAVGVSEHAEASDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=844424 QLQ02_RS04885 WP_024120213.1 960020..960142(-) (phrC) [Bacillus mojavensis strain KRS009]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCTGCAGCAGCTGTTTTTACAGCGGTTGGCGTCTCTGAACATGC
TGAAGCATCCGACTTTCATGTCACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

87.5

100

0.875