Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   QN218_RS16760 Genome accession   NZ_CP126534
Coordinates   3297812..3297934 (-) Length   40 a.a.
NCBI ID   WP_003240188.1    Uniprot ID   A0A9Q4EQJ2
Organism   Bacillus inaquosorum strain BSY82     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 3292812..3302934
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  QN218_RS16735 yclP 3293067..3293825 (-) 759 WP_003240196.1 petrobactin ABC transporter ATP-binding protein YclP -
  QN218_RS16740 yclO 3293819..3294766 (-) 948 WP_060397923.1 petrobactin ABC transporter permease YclO -
  QN218_RS16745 ceuB 3294759..3295709 (-) 951 WP_003240192.1 petrobactin ABC transporter permease YclN Machinery gene
  QN218_RS16750 - 3296094..3297458 (+) 1365 WP_060397922.1 aspartate kinase -
  QN218_RS16755 - 3297609..3297716 (+) 108 WP_019257466.1 YjcZ family sporulation protein -
  QN218_RS16760 phrC 3297812..3297934 (-) 123 WP_003240188.1 phosphatase RapC inhibitor PhrC Regulator
  QN218_RS16765 rapC 3297918..3299066 (-) 1149 WP_019257465.1 response regulator aspartate phosphatase RapC Regulator
  QN218_RS16770 - 3299224..3300645 (-) 1422 WP_080428959.1 HAMP domain-containing sensor histidine kinase -
  QN218_RS16775 yclJ 3300632..3301315 (-) 684 WP_003240180.1 two-component system response regulator YclJ -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4242.04 Da        Isoelectric Point: 8.0285

>NTDB_id=838584 QN218_RS16760 WP_003240188.1 3297812..3297934(-) (phrC) [Bacillus inaquosorum strain BSY82]
MKLKSKLFVICLAAAAIFTVAGVSANAESLDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=838584 QN218_RS16760 WP_003240188.1 3297812..3297934(-) (phrC) [Bacillus inaquosorum strain BSY82]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGTGGCTGGCGTTTCTGCTAACGC
CGAATCACTCGACTTTCATGTAACGGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

95

100

0.95