Detailed information    

insolico Bioinformatically predicted

Overview

Name   sinI   Type   Regulator
Locus tag   QNH41_RS13310 Genome accession   NZ_CP126100
Coordinates   2590117..2590290 (+) Length   57 a.a.
NCBI ID   WP_024122036.1    Uniprot ID   -
Organism   Bacillus halotolerans strain LN2     
Function   inhibit the expression of sinR (predicted from homology)   
Competence regulation

Genomic Context

Location: 2585117..2595290
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  QNH41_RS13295 (QNH41_13295) gcvT 2585911..2587002 (-) 1092 WP_283912449.1 glycine cleavage system aminomethyltransferase GcvT -
  QNH41_RS13300 (QNH41_13300) - 2587446..2589119 (+) 1674 WP_283912450.1 SNF2-related protein -
  QNH41_RS13305 (QNH41_13305) - 2589139..2589933 (+) 795 WP_283912451.1 YqhG family protein -
  QNH41_RS13310 (QNH41_13310) sinI 2590117..2590290 (+) 174 WP_024122036.1 anti-repressor SinI family protein Regulator
  QNH41_RS13315 (QNH41_13315) sinR 2590324..2590659 (+) 336 WP_003226345.1 transcriptional regulator SinR Regulator
  QNH41_RS13320 (QNH41_13320) tasA 2590746..2591531 (-) 786 WP_106020091.1 biofilm matrix protein TasA -
  QNH41_RS13325 (QNH41_13325) - 2591596..2592180 (-) 585 WP_105955579.1 signal peptidase I -
  QNH41_RS13330 (QNH41_13330) tapA 2592152..2592913 (-) 762 WP_106020093.1 amyloid fiber anchoring/assembly protein TapA -
  QNH41_RS13335 (QNH41_13335) - 2593190..2593513 (+) 324 WP_024122040.1 YqzG/YhdC family protein -
  QNH41_RS13340 (QNH41_13340) - 2593556..2593735 (-) 180 WP_003236949.1 YqzE family protein -
  QNH41_RS13345 (QNH41_13345) comGG 2593807..2594181 (-) 375 WP_106020094.1 competence type IV pilus minor pilin ComGG Machinery gene
  QNH41_RS13350 (QNH41_13350) comGF 2594182..2594565 (-) 384 WP_038954226.1 competence type IV pilus minor pilin ComGF Machinery gene
  QNH41_RS13355 (QNH41_13355) comGE 2594591..2594938 (-) 348 WP_106020095.1 competence type IV pilus minor pilin ComGE Machinery gene

Sequence

Protein


Download         Length: 57 a.a.        Molecular weight: 6675.62 Da        Isoelectric Point: 6.7231

>NTDB_id=835892 QNH41_RS13310 WP_024122036.1 2590117..2590290(+) (sinI) [Bacillus halotolerans strain LN2]
MKNAKQEHFELDQEWVELMMEAREANISPEEIRKYLLLNKKSAHPGPAARSHTINPF

Nucleotide


Download         Length: 174 bp        

>NTDB_id=835892 QNH41_RS13310 WP_024122036.1 2590117..2590290(+) (sinI) [Bacillus halotolerans strain LN2]
ATGAAAAATGCAAAACAAGAGCACTTCGAATTAGATCAAGAATGGGTTGAATTAATGATGGAAGCCAGAGAAGCAAATAT
CAGCCCTGAGGAAATACGCAAATATTTACTTTTAAACAAAAAGTCTGCTCATCCTGGTCCGGCAGCCAGAAGTCATACCA
TAAATCCTTTCTGA

Domains

Predicted by InterproScan.

Anti-repressor SinI (SinI)

(11-36)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  sinI Bacillus subtilis subsp. subtilis str. 168

94.737

100

0.947